Neurogranin (NRGN) (NM_001126181) Human Untagged Clone

CAT#: SC322795

NRGN (untagged)-Human neurogranin (protein kinase C substrate, RC3) (NRGN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NRGN
• Synonyms: hng; RC3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001126181, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACTGCTGCACCGAGAACGCCTGCTCCAAGCCGGACGACGACATTCTAGACATCCCGCTGGACGATC
  CCGGCGCCAACGCGGCCGCCGCCAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGCGGAAGAAGATAAA
  GAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGGTGGCCCGGGGAGGC
  GCGGGCGGCGGCCCCAGCGGAGACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001126181
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001126181.1, NP_001119653.1
• RefSeq Size: 1238 bp
• RefSeq ORF: 237 bp
• Locus ID: 4900
• Cytogenetics: 11q24.2
• Protein Families: Druggable Genome
• Gene Summary: 'Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) uses an alternate splice acceptor site in a 3'UTR exon.