CSAG3 (NM_001129828) Human Untagged Clone

CAT#: SC322812

CSAG3 (untagged)-Human CSAG family, member 3 (CSAG3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CSAG3
• Synonyms: CSAG3A; CT24.2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001129828, the custom clone sequence may differ by one or more nucleotides
  ATGTGGATGGGCCTCATCCAATTAGTTGAAGGTGTTAAGAGAAAAGACCAAGGTTTCCTG
  GAAAAGGAATTCTACCACAAGACTAACATAAAAATGCGCTGTGAGTTTCTAGCCTGCTGG
  CCTGCCTTCACTGTCCTGGGGGAGGCTTGGAGAGACCAGGTGGACTGGAGTAGACTGTTG
  AGAGACGCTGGTCTGGTGAAGATGTCCAGGAAACCACGAGCCTCCAGCCCATTGTCCAAC
  AACCACCCACCAACACCAAAGAGGTTCCCAAGACAACCCGGAAGGGAAAAGGGACCCATC
  AAGGAAGTTCCAGGAACAAAAGGCTCTCCC
  
• Restriction Sites: Please inquire
• ACCN: NM_001129828
• ORF Size: 333 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001129828.1, NP_001123300.1
• RefSeq Size: 796
• RefSeq ORF: 333
• Locus ID: 389903
• Gene Summary: Drug-resistance related protein, its expression is associated with the chemotherapy resistant and neoplastic phenotype. May also be linked to the malignant phenotype. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2, also known as TRAG-3) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a.