FXYD2 (NM_001127489) Human Untagged Clone

CAT#: SC322850

FXYD2 (untagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant c

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FXYD2
• Synonyms: ATP1G1; HOMG2; MGC12372
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001127489, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTGGGTTGTCGATGGACGGTGGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATGGTAAGC
  CTGGGCCCCTGCGCACCCTTCCTGAGCCCTCAGGACCCCTTCCACCAAGCAGCGGCCTCTCCCAGCCCCA
  GGTCCATGCTCTGTGCCCCTTATCTCCCCTGGTTACCACGGGCTGCTGCGGGCAGGCTGCGGAGAGAGAC
  AGCTGCTGGGAGAGACCACCCATCCCGCTCCTCTTGCCCTCTCTTTCCGGAGACTATGAGACCGTTCGCA
  ATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCTCCTCAGTAAGTGGGGTGG
  CCTCCAGGGAAGGGGTGCTGACCAGGGCACCTCTCTTCTCAAGGCCGCTGAGCAGGCTGGCTTTCGGGAG
  TTGCCAAGGGAGGGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001127489
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001127489.1, NP_001120961.1
• RefSeq Size: 2747 bp
• RefSeq ORF: 438 bp
• Locus ID: 486
• Cytogenetics: 11q23.3
• Protein Families: Druggable Genome, Ion Channels: Other, Transmembrane
• Gene Summary: 'This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes the sodium/potassium-transporting ATPase subunit gamma. Mutations in this gene have been associated with Renal Hypomagnesemia-2. Alternatively spliced transcript variants have been described. Read-through transcripts have been observed between this locus and the upstream FXYD domain-containing ion transport regulator 6 (FXYD6, GeneID 53826) locus.[provided by RefSeq, Feb 2011]'
  Transcript Variant: This variant (c) is missing several coding exons at the 3' end and contains a different 3' terminal exon compared to transcript variant a. This results in a longer isoform (3) with a novel internal segment and a different C-terminus, compared to isoform 1.