GBA3 (NM_001128432) Human Untagged Clone

CAT#: SC322858

GBA3 (untagged)-Human glucosidase, beta, acid 3 (cytosolic) (GBA3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GBA3
• Synonyms: CBG; CBGL1; GLUC; KLRP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001128432, the custom clone sequence may differ by one or more nucleotides
  ATGGCTTTCCCTGCAGGATTTGGATGGGCGGCAGCCACTGCAGCTTATCAAGTAGAAGGA
  GGCTGGGATGCAGATGGAAAAGGCCCTTGTGTCTGGGACACATTTACTCATCAGGGAGGA
  GAGAGAGTTTTCAAGAACCAGACTGGCGATGTAGCTTGTGGCAGCTACACTCTGTGGGAG
  GAAGATTTGAAATGTATCAAACAGCTTGGATTGACTCATTACCGCTTCTCTCTTTCCTGG
  TCACGTCTGTTACCTGATGGGACGACAGGTTTCATCAACCAGAAAGCTATCCAACTTGAT
  AAAGTCAATCTTCAAGTATATTGTGCATGGTCTCTTCTGGATAACTTTGAGTGGAACCAG
  GGATACAGCAGCCGGTTTGGTCTCTTCCACGTTGATTTTGAAGACCCAGCTAGACCCCGA
  GTCCCTTACACATCGGCCAAGGAATATGCCAAGATCATCCGAAACAATGGCCTTGAAGCA
  CATCTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001128432
• ORF Size: 489 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001128432.1, NP_001121904.1
• RefSeq Size: 1226
• RefSeq ORF: 489
• Locus ID: 57733
• Protein Pathways: Cyanoamino acid metabolism, Starch and sucrose metabolism
• Gene Summary: The protein encoded by this gene is an enzyme that can hydrolyze several types of glycosides. This gene is a polymorphic pseudogene, with the most common allele being the functional allele that encodes the full-length protein. Some individuals, as represented by the reference genome allele, contain a single nucleotide polymorphism that results in a premature stop codon in the coding region, and therefore this allele is pseudogenic due to the failure to produce a functional full-length protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2013]
  Transcript Variant: This variant (2, coding) lacks two alternate exons resulting in the loss of an in-frame segment in the central coding region, compared to variant 1. The encoded isoform (b) has the same N- and C-termini but is shorter compared to isoform a. This variant is produced from the more frequently occurring functional allele of this gene.