ZNF673 (KRBOX4) (NM_001129898) Human Untagged Clone

CAT#: SC322864

KRBOX4 (untagged)-Human zinc finger family member 673 (ZNF673), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KRBOX4
• Synonyms: ZNF673
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001129898, the custom clone sequence may differ by one or more nucleotides
  ATGGCCATGTCCCAGGAATCATTGACCTTCAAGGACGTGTTTGTGGACTTCACCCTGGAG
  GAGTGGCAGCAACTGGACTCTGCCCAGAAGAACCTCTACAGGGATGTCATGCTTGAGAAC
  TACAGCCACCTGGTGTCCGTGGGGTATCTAGTTGCGAAGCCAGATGTGATCTTCAGGTTG
  GGACCAGGTGAAGAGTCCTGGATGGCAGATGGGGGGACCCCGGTACGGACCTGTGCAGGT
  GAGGACAGGCCAGAAGTCTGGCAAGTTGATGAGCAGATAGATCACTACAAGGAAAGCCAA
  GACAAACTTCCTTGGCAAGCTGCATTCATAGGCAAGGAAACACTGAAGGATGAAAGCGGT
  CAAGAATCCAGAACATGTAGAAAAAGCATTTATCTGAGCACAGAATTTGATTCTGTAAGG
  CAAAGACTCCCTAAATATTATTCGTGGGAAAAGGCATTCAAAACATCATTTAAACTTTCT
  TGGTCAAAATGGAAGCTATGTAAGAAAGAAAGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001129898
• ORF Size: 516 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001129898.1, NP_001123370.1
• RefSeq Size: 2458
• RefSeq ORF: 516
• Locus ID: 55634
• Protein Families: Transcription Factors
• Gene Summary: This encodes a zinc finger protein with an N-terminal KRAB (Kruppel-associated) domain found in transcriptional repressors. This gene is located in a region of the X chromosome thought to be involved in nonsyndromic X-linked cognitive disability. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (1) represents the longest transcript and it encodes the longest protein (isoform 1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.