HP1 alpha (CBX5) (NM_001127321) Human Untagged Clone
CAT#: SC322879
CBX5 (untagged)-Human chromobox homolog 5 (CBX5), transcript variant 2
"NM_001127321" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CBX5 |
Synonyms | HEL25; HP1; HP1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001127321, the custom clone sequence may differ by one or more nucleotides
ATGGGAAAGAAAACCAAGCGGACAGCTGACAGTTCTTCTTCAGAGGATGAGGAGGAGTATGTTGTGGAGA AGGTGCTAGACAGGCGCGTGGTTAAGGGACAAGTGGAATATCTACTGAAGTGGAAAGGCTTTTCTGAGGA GCACAATACTTGGGAACCTGAGAAAAACTTGGATTGCCCTGAGCTAATTTCTGAATTTATGAAAAAGTAT AAGAAGATGAAGGAGGGTGAAAATAATAAACCCAGGGAGAAGTCAGAAAGTAACAAGAGGAAATCCAATT TCTCAAACAGTGCCGATGACATCAAATCTAAAAAAAAGAGAGAGCAGAGCAATGATATCGCTCGGGGCTT TGAGAGAGGACTGGAACCAGAAAAGATCATTGGGGCAACAGATTCCTGTGGTGATTTAATGTTCCTAATG AAATGGAAAGACACAGATGAAGCTGACCTGGTTCTTGCAAAAGAAGCTAATGTGAAATGTCCACAAATTG TGATAGCATTTTATGAAGAGAGACTGACATGGCATGCATATCCTGAGGATGCGGAAAACAAAGAGAAAGA AACAGCAAAGAGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127321 |
ORF Size | 576 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001127321.1, NP_001120793.1 |
RefSeq Size | 11525 |
RefSeq ORF | 576 |
Locus ID | 23468 |
Gene Summary | This gene encodes a highly conserved nonhistone protein, which is a member of the heterochromatin protein family. The protein is enriched in the heterochromatin and associated with centromeres. The protein has a single N-terminal chromodomain which can bind to histone proteins via methylated lysine residues, and a C-terminal chromo shadow-domain (CSD) which is responsible for the homodimerization and interaction with a number of chromatin-associated nonhistone proteins. The encoded product is involved in the formation of functional kinetochore through interaction with essential kinetochore proteins. The gene has a pseudogene located on chromosome 3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence and transcripts to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225208 | CBX5 (Myc-DDK-tagged)-Human chromobox homolog 5 (CBX5), transcript variant 2 |
USD 420.00 |
|
RG225208 | CBX5 (GFP-tagged) - Human chromobox homolog 5 (CBX5), transcript variant 2 |
USD 460.00 |
|
RC225208L1 | Lenti ORF clone of Human chromobox homolog 5 (CBX5), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC225208L2 | Lenti ORF clone of Human chromobox homolog 5 (CBX5), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC225208L3 | Lenti ORF clone of Human chromobox homolog 5 (CBX5), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC225208L4 | Lenti ORF clone of Human chromobox homolog 5 (CBX5), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review