CSRP3 (NM_001127656) Human Untagged Clone

CAT#: SC322883

CSRP3 (untagged)-Human cysteine and glycine-rich protein 3 (cardiac LIM protein) (CSRP3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CSRP3
• Synonyms: CLP; CMD1M; CMH12; CRP3; LMO4; MLP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001127656, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCAAACTGGGGCGGAGGCGCAAAATGTGGAGCCTGTGAAAAGACCGTCTACCATGCAGAAGAAATCC
  AGTGCAATGGAAGGAGTTTCCACAAGACGTGTTTCCACTGCATGGCCTGCAGGAAGGCTCTTGACAGCAC
  GACAGTCGCGGCTCATGAGTCGGAGATCTACTGCAAGGTGTGCTATGGGCGCAGATATGGCCCCAAAGGG
  ATCGGGTATGGACAAGGCGCTGGCTGTCTCAGCACAGACACGGGCGAGCATCTCGGCCTGCAGTTCCAAC
  AGTCCCCAAAGCCGGCACGCTCAGTTACCACCAGCAACCCTTCCAAATTCACTGCGAAGTTTGGAGAGTC
  CGAGAAGTGCCCTCGATGTGGCAAGTCAGTCTATGCTGCTGAGAAGGTTATGGGAGGTGGCAAGCCTTGG
  CACAAGACCTGTTTCCGCTGTGCCATCTGTGGGAAGAGTCTGGAGTCCACAAATGTCACTGACAAAGATG
  GGGAACTTTATTGCAAAGTTTGCTATGCCAAAAATTTTGGCCCCACGGGTATTGGGTTTGGAGGCCTTAC
  ACAACAAGTGGAAAAGAAAGAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001127656
• ORF Size: 585 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001127656.1, NP_001121128.1
• RefSeq Size: 1286
• RefSeq ORF: 585
• Locus ID: 8048
• Gene Summary: This gene encodes a member of the CSRP family of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this protein is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Mutations in this gene are thought to cause heritable forms of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) in humans. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) contains an alternatively spliced and an additional 5' non-coding exon, therefore, has a different 5' UTR compared to variant 1. Transcript variants 1 and 2 encode the same protein.