CSRP3 (NM_001127656) Human Untagged Clone

CAT#: SC322883

CSRP3 (untagged)-Human cysteine and glycine-rich protein 3 (cardiac LIM protein) (CSRP3), transcript variant 2


  "NM_001127656" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CSRP3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CSRP3
Synonyms CLP; CMD1M; CMH12; CRP3; LMO4; MLP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001127656, the custom clone sequence may differ by one or more nucleotides


ATGCCAAACTGGGGCGGAGGCGCAAAATGTGGAGCCTGTGAAAAGACCGTCTACCATGCAGAAGAAATCC
AGTGCAATGGAAGGAGTTTCCACAAGACGTGTTTCCACTGCATGGCCTGCAGGAAGGCTCTTGACAGCAC
GACAGTCGCGGCTCATGAGTCGGAGATCTACTGCAAGGTGTGCTATGGGCGCAGATATGGCCCCAAAGGG
ATCGGGTATGGACAAGGCGCTGGCTGTCTCAGCACAGACACGGGCGAGCATCTCGGCCTGCAGTTCCAAC
AGTCCCCAAAGCCGGCACGCTCAGTTACCACCAGCAACCCTTCCAAATTCACTGCGAAGTTTGGAGAGTC
CGAGAAGTGCCCTCGATGTGGCAAGTCAGTCTATGCTGCTGAGAAGGTTATGGGAGGTGGCAAGCCTTGG
CACAAGACCTGTTTCCGCTGTGCCATCTGTGGGAAGAGTCTGGAGTCCACAAATGTCACTGACAAAGATG
GGGAACTTTATTGCAAAGTTTGCTATGCCAAAAATTTTGGCCCCACGGGTATTGGGTTTGGAGGCCTTAC
ACAACAAGTGGAAAAGAAAGAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001127656
ORF Size 585 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001127656.1, NP_001121128.1
RefSeq Size 1286
RefSeq ORF 585
Locus ID 8048
Gene Summary This gene encodes a member of the CSRP family of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this protein is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Mutations in this gene are thought to cause heritable forms of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) in humans. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) contains an alternatively spliced and an additional 5' non-coding exon, therefore, has a different 5' UTR compared to variant 1. Transcript variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.