AKIP (AURKAIP1) (NM_001127230) Human Untagged Clone

CAT#: SC322888

AURKAIP1 (untagged)-Human aurora kinase A interacting protein 1 (AURKAIP1), transcript variant 3


  "NM_001127230" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AURKAIP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AURKAIP1
Synonyms AIP; AKIP; MRP-S38
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001127230, the custom clone sequence may differ by one or more nucleotides


ATGCTCCTGGGGCGCCTGACTTCCCAGCTGTTGAGGGCCGTTCCTTGGGCAGGCGGCCGCCCGCCTTGGC
CCGTCTCTGGAGTGCTGGGCAGCCGGGTCTGCGGGCCCCTTTACAGCACATCGCCGGCCGGCCCAGGTAG
GGCGGCCTCTCTCCCTCGCAAGGGGGCCCAGCTGGAGCTGGAGGAGATGCTGGTCCCCAGGAAGATGTCC
GTCAGCCCCCTGGAGAGCTGGCTCACGGCCCGCTGCTTCCTGCCCAGACTGGATACCGGGACCGCAGGGA
CTGTGGCTCCACCGCAATCCTACCAGTGTCCGCCCAGCCAGATAGGGGAAGGGGCCGAGCAGGGGGATGA
AGGCGTCGCGGATGCGCCTCAAATTCAGTGCAAAAACGTGCTGAAGATCCGCCGGCGGAAGATGAACCAC
CACAAGTACCGGAAGCTGGTGAAGAAGACGCGGTTCCTGCGGAGGAAGGTCCAGGAGGGACGCCTGAGAC
GCAAGCAGATCAAGTTCGAGAAAGACCTGAGGCGCATCTGGCTGAAGGCGGGGCTAAAGGAAGCCCCCGA
AGGCTGGCAGACCCCCAAGATCTACCTGCGGGGCAAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001127230
ORF Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001127230.1, NP_001120702.1
RefSeq Size 826
RefSeq ORF 600
Locus ID 54998
Protein Families Druggable Genome
Gene Summary May act as a negative regulator of Aurora-A kinase, by down-regulation through proteasome-dependent degradation. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) has a 5'UTR resulting from use of an alternate splice donor site.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.