CRLS1 (NM_001127458) Human Untagged Clone

CAT#: SC322890

CRLS1 (untagged)-Human cardiolipin synthase 1 (CRLS1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRLS1
• Synonyms: C20orf155; CLS; CLS1; dJ967N21.6; GCD10
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001127458, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCACAGTATGAAAACCCATGGACAATCCCGAATATGTTGTCAATGACGAGAATTGGCTTGGCCCCAG
  TTCTGGGCTATTTGATTATTGAAGAAGATTTTAATATTGCACTAGGAGTTTTTGCTTTAGCTGGACTAAC
  AGATTTGTTGGATGGATTTATTGCTCGAAACTGGGCCAATCAAAGATCAGCTTTGGGAAGTGCTCTTGAT
  CCACTTGCTGATAAAATACTTATCAGTATCTTATATGTTAGCTTGACCTATGCAGATCTTATTCCAGTTC
  CACTTACTTACATGATCATTTCGAGAGATGTAATGTTGATTGCTGCTGTTTTTTATGTCAGATACCGAAC
  TCTTCCAACACCACGAACACTTGCCAAGTATTTCAATCCTTGCTATGCCACTGCTAGGTTAAAACCAACA
  TTCATCAGCAAGGTGAATACAGCAGTCCAGTTAATCTTGGTGGCAGCTTCTTTGGCAGCTCCAGTTTTCA
  ACTATGCTGACAGCATTTATCTTCAGATACTATGGTGTTTTACAGCTTTCACCACAGCTGCATCAGCTTA
  TAGTTACTATCATTATGGCCGGAAGACTGTTCAGGTGATAAAAGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001127458
• ORF Size: 609 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001127458.1, NP_001120930.1
• RefSeq Size: 3667
• RefSeq ORF: 609
• Locus ID: 54675
• Protein Families: Transmembrane
• Protein Pathways: Glycerophospholipid metabolism, Metabolic pathways
• Gene Summary: This gene encodes a member of the CDP-alcohol phosphatidyltransferase class-I family of proteins. The encoded enzyme catalyzes the synthesis of cardiolipin, a phospholipid component of mitochondrial membranes that is critical for mitochondrial function. [provided by RefSeq, Apr 2016]
  Transcript Variant: This variant (2) uses an alternate first exon which contains the translation initiation site. The resulting protein isoform (2) has a short distinct N-terminus.