CLDN19 (NM_001123395) Human Untagged Clone

CAT#: SC322900

CLDN19 (untagged)-Human claudin 19 (CLDN19), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLDN19
• Synonyms: HOMG5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001123395, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCAACTCAGGCCTCCAGCTCCTGGGCTACTTCTTGGCCCTGGGTGGCTGGGTGGGCATCATTGCTA
  GCACAGCCCTGCCACAGTGGAAGCAGTCTTCCTACGCAGGCGACGCCATCATCACTGCCGTGGGCCTCTA
  TGAAGGGCTCTGGATGTCCTGCGCCTCCCAGAGCACTGGGCAAGTGCAGTGCAAGCTCTACGACTCGCTG
  CTCGCCCTGGACGGTCACATCCAATCAGCGCGGGCCCTGATGGTGGTGGCCGTGCTCCTGGGCTTCGTGG
  CCATGGTCCTCAGCGTAGTTGGCATGAAGTGTACGCGGGTGGGAGACAGCAACCCCATTGCCAAGGGCCG
  TGTTGCCATCGCCGGGGGAGCCCTCTTCATCCTGGCAGGCCTCTGCACTTTGACTGCTGTCTCGTGGTAT
  GCCACCCTGGTGACCCAGGAGTTCTTCAACCCAAGCACACCTGTCAATGCCAGGTATGAATTTGGCCCAG
  CCCTGTTCGTGGGCTGGGCCTCAGCTGGCCTGGCCGTGCTGGGCGGCTCCTTCCTCTGCTGCACATGCCC
  GGAGCCAGAGAGACCCAACAGCAGCCCACAGCCCTATCGGCCTGGACCCTCTGCTGCTGCCCGAGAGTAC
  GTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001123395
• ORF Size: 636 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001123395.1, NP_001116867.1
• RefSeq Size: 3602
• RefSeq ORF: 636
• Locus ID: 149461
• Protein Families: Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
• Gene Summary: The product of this gene belongs to the claudin family. It plays a major role in tight junction-specific obliteration of the intercellular space, through calcium-independent cell-adhesion activity. Defects in this gene are the cause of hypomagnesemia renal with ocular involvement (HOMGO). HOMGO is a progressive renal disease characterized by primary renal magnesium wasting with hypomagnesemia, hypercalciuria and nephrocalcinosis associated with severe ocular abnormalities such as bilateral chorioretinal scars, macular colobomata, significant myopia and nystagmus. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (2) contains an additional segment in the coding region compared to variant 1. The resulting isoform (b) contains a shorter and distinct C-terminus compared to isoform a.