MAD2L2 (NM_001127325) Human Untagged Clone
CAT#: SC322901
MAD2L2 (untagged)-Human MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2), transcript variant 1
"NM_001127325" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MAD2L2 |
Synonyms | FANCV; MAD2B; POLZ2; REV7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001127325, the custom clone sequence may differ by one or more nucleotides
ATGACCACGCTCACACGACAAGACCTCAACTTTGGCCAAGTGGTGGCCGATGTGCTCTGCGAGTTCCTGG AGGTGGCTGTGCATCTCATCCTCTACGTGCGCGAGGTCTACCCCGTGGGCATCTTCCAGAAACGCAAGAA GTACAACGTGCCGGTCCAGATGTCCTGCCACCCGGAGCTGAATCAGTATATCCAGGACACGCTGCACTGC GTCAAGCCACTCCTGGAGAAGAATGATGTGGAGAAAGTGGTGGTGGTGATTTTGGATAAAGAGCACCGCC CAGTGGAGAAATTCGTCTTTGAGATCACCCAGCCTCCACTGCTGTCCATCAGCTCAGACTCGCTGTTGTC TCATGTGGAGCAGCTGCTCCGGGCCTTCATCCTGAAGATCAGCGTGTGCGATGCCGTCCTGGACCACAAC CCCCCAGGCTGTACCTTCACAGTCCTGGTGCACACGAGAGAAGCCGCCACTCGCAACATGGAGAAGATCC AGGTCATCAAGGATTTCCCCTGGATCCTGGCGGATGAGCAGGATGTCCACATGCATGACCCCCGGCTGAT ACCACTAAAAACCATGACGTCGGACATTTTAAAGATGCAGCTTTACGTGGAAGAGCGCGCTCATAAAGGC AGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127325 |
ORF Size | 636 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001127325.1, NP_001120797.1 |
RefSeq Size | 1196 |
RefSeq ORF | 636 |
Locus ID | 10459 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation |
Gene Summary | The protein encoded by this gene is a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. The encoded protein, which is similar to MAD2L1, is capable of interacting with ADAM9, ADAM15, REV1, and REV3 proteins. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) has the 5'-most first exon. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225253 | MAD2L2 (Myc-DDK-tagged)-Human MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2), transcript variant 1 |
USD 420.00 |
|
RG225253 | MAD2L2 (GFP-tagged) - Human MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2), transcript variant 1 |
USD 460.00 |
|
RC225253L3 | Lenti ORF clone of Human MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC225253L4 | Lenti ORF clone of Human MAD2 mitotic arrest deficient-like 2 (yeast) (MAD2L2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review