FAM119A (METTL21A) (NM_001127395) Human Untagged Clone

CAT#: SC322903

METTL21A (untagged)-Human methyltransferase like 21A (METTL21A), transcript variant 2


  "NM_001127395" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "METTL21A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol METTL21A
Synonyms FAM119A; HCA557b; HSPA-KMT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001127395, the custom clone sequence may differ by one or more nucleotides


ATGGCCCTCGTGCCCTATGAGGAGACCACGGAATTTGGGTTGCAGAAATTCCACAAGCCTCTTGCAACTT
TTTCCTTTGCAAACCACACGATCCAGATCCGGCAGGACTGGAGACACCTGGGAGTCGCAGCGGTGGTTTG
GGATGCGGCCATCGTTCTTTCCACATACCTGGAGATGGGAGCTGTGGAGCTCAGGGGCCGCTCTGCCGTG
GAGCTGGGTGCTGGCACGGGGCTGGTGGGCATAGTGGCTGCCCTGCTGGGTGCTCATGTGACTATCACGG
ATCGAAAAGTAGCATTAGAATTTCTTAAATCAAACGTTCAAGCCAACTTACCTCCTCATATCCAAACTAA
AACTGTTGTTAAGGAGCTGACTTGGGGACAAAATTTGGGGAGTTTTTCTCCTGGAGAATTTGACCTGATA
CTTGGTGCTGATATCATATATTTAGAAGAAACATTCACAGATCTTCTTCAGACACTGGAACATCTCTGTA
GCAATCACTCTGTGATTCTTTTAGCATGCCGAATTCGCTATGAACGGGATAACAACTTCTTAGCAATGCT
GGAGAGGCAATTTACTGTGAGAAAGGTTCACTACGATCCTGAAAAAGATGTACATATTTACGAAGCACAG
AAGAGAAACCAGAAGGAGGACTTATAA


Restriction Sites SgfI-MluI     
ACCN NM_001127395
ORF Size 657 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001127395.2, NP_001120867.1
RefSeq Size 4897
RefSeq ORF 657
Locus ID 151194
Gene Summary Protein-lysine methyltransferase that selectively trimethylates residues in heat shock protein 70 (HSP70) family members. Contributes to the in vivo trimethylation of Lys residues in HSPA1 and HSPA8. In vitro methylates 'Lys-561' in HSPA1, 'Lys-564' in HSPA2, 'Lys-585' in HSPA5, 'Lys-563' in HSPA6 and 'Lys-561' in HSPA8. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.