CD16 (FCGR3A) (NM_001127592) Human Untagged Clone
CAT#: SC322953
FCGR3A (untagged)-Human Fc fragment of IgG, low affinity IIIa, receptor (CD16a) (FCGR3A), transcript variant 2
"NM_001127592" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FCGR3A |
Synonyms | CD16; CD16A; FCG3; FCGR3; FCGRIII; FCR-10; FCRIII; FCRIIIA; IGFR3; IMD20 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001127592 edited
ATGGGTGGAGGGGCTGGGGAAAGGCTGTTTACTTCCTCCTGTCTAGTCGGTTTGGTCCCT TTAGGGCTCCGGATATCTTTGGTGACTTGTCCACTCCAGTGTGGCATCATGTGGCAGCTG CTCCTCCCAACTGCTCTGCTACTTCTAGTTTCAGCTGGCATGCGGACTGATCTCCCAAAG GCTGTGGTGTTCCTGGAGCCTCAATGGTACAGGGTGCTCGAGAAGGACAGTGTGACTCTG AAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACAGTGGTTTCACAATGAGAGC CTCATCTCAAGCCAGGCCTCGAGCTACTTCATTGACGCTGCCACAGTCGACGACAGTGGA GAGTACAGGTGCCAGACAAACCTCTCCACCCTCAGTGACCCGGTGCAGCTAGAAGTCCAT ATCGGCTGGCTGTTGCTCCAGGCCCCTCGGTGGGTGTTCAAGGAGGAAGACCCTATTCAC CTGAGGTGTCACAGCTGGAAGAACACTGCTCTGCATAAGGTCACATATTTACAGAATGGC AAAGGCAGGAAGTATTTTCATCATAATTCTGACTTCTACATTCCAAAAGCCACACTCAAA GACAGCGGCTCCTACTTCTGCAGGGGGCTTTTTGGGAGTAAAAATGTGTCTTCAGAGACT GTGAACATCACCATCACTCAAGGTTTGGCAGTGTCAACCATCTCATCATTCTTTCCACCT GGGTACCAAGTCTCTTTCTGCTTGGTGATGGTACTCCTTTTTGCAGTGGACACAGGACTA TATTTCTCTGTGAAGACAAACATTCGAAGCTCAACAAGAGACTGGAAGGACCATAAATTT AAATGGAGAAAGGACCCTCAAGACAAATGA |
Restriction Sites | Please inquire |
ACCN | NM_001127592 |
Insert Size | 2300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127592.1, NP_001121064.1 |
RefSeq Size | 2338 bp |
RefSeq ORF | 870 bp |
Locus ID | 2214 |
Cytogenetics | 1q23.3 |
Protein Families | ES Cell Differentiation/IPS, Secreted Protein, Transmembrane |
Protein Pathways | Fc gamma R-mediated phagocytosis, Natural killer cell mediated cytotoxicity, Systemic lupus erythematosus |
Gene Summary | 'This gene encodes a receptor for the Fc portion of immunoglobulin G, and it is involved in the removal of antigen-antibody complexes from the circulation, as well as other responses, including antibody dependent cellular mediated cytotoxicity and antibody dependent enhancement of virus infections. This gene (FCGR3A) is highly similar to another nearby gene (FCGR3B) located on chromosome 1. The receptor encoded by this gene is expressed on natural killer (NK) cells as an integral membrane glycoprotein anchored through a transmembrane peptide, whereas FCGR3B is expressed on polymorphonuclear neutrophils (PMN) where the receptor is anchored through a phosphatidylinositol (PI) linkage. Mutations in this gene are associated with immunodeficiency 20, and have been linked to susceptibility to recurrent viral infections, susceptibility to systemic lupus erythematosus, and alloimmune neonatal neutropenia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2020]' Transcript Variant: This variant (2) retains an intron in its 5' UTR and 5' coding region, and uses an alternate in-frame splice site in its 5' coding region compared to variant 3. The encoded isoform (2) is longer than isoform c. This isoform (b) lacks a predicted signal peptide compared to isoform c. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225398 | FCGR3A (Myc-DDK-tagged)-Human Fc fragment of IgG, low affinity IIIa, receptor (CD16a) (FCGR3A), transcript variant 2 |
USD 420.00 |
|
RG225398 | FCGR3A (GFP-tagged) - Human Fc fragment of IgG, low affinity IIIa, receptor (CD16a) (FCGR3A), transcript variant 2 |
USD 460.00 |
|
RC225398L3 | Lenti-ORF clone of FCGR3A (Myc-DDK-tagged)-Human Fc fragment of IgG, low affinity IIIa, receptor (CD16a) (FCGR3A), transcript variant 2 |
USD 620.00 |
|
RC225398L4 | Lenti-ORF clone of FCGR3A (mGFP-tagged)-Human Fc fragment of IgG, low affinity IIIa, receptor (CD16a) (FCGR3A), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review