Heme oxygenase 2 (HMOX2) (NM_001127206) Human Untagged Clone

CAT#: SC322970

HMOX2 (untagged)-Human heme oxygenase (decycling) 2 (HMOX2), transcript variant 4


  "NM_001127206" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HMOX2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HMOX2
Synonyms HO-2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001127206, the custom clone sequence may differ by one or more nucleotides
ATGTCAGCGGAAGTGGAAACCTCAGAGGGGGTAGACGAGTCAGAAAAAAAGAACTCTGGG
GCCCTAGAAAAGGAGAACCAAATGAGAATGGCTGACCTCTCGGAGCTCCTGAAGGAAGGG
ACCAAGGAAGCACACGACCGGGCAGAAAACACCCAGTTTGTCAAGGACTTCTTGAAAGGC
AACATTAAGAAGGAGCTGTTTAAGCTGGCCACCACGGCACTTTACTTCACATACTCAGCC
CTCGAGGAGGAAATGGAGCGCAACAAGGACCATCCAGCCTTTGCCCCTTTGTACTTCCCC
ATGGAGCTGCACCGGAAGGAGGCGCTGACCAAGGACATGGAGTATTTCTTTGGTGAAAAC
TGGGAGGAGCAGGTGCAGTGCCCCAAGGCTGCCCAGAAGTACGTGGAGCGGATCCACTAC
ATAGGGCAGAACGAGCCGGAGCTACTGGTGGCCCATGCATACACCCGCTACATGGGGGAT
CTCTCGGGGGGCCAGGTGCTGAAGAAGGTGGCCCAGCGAGCACTGAAACTCCCCAGCACA
GGGGAAGGGACCCAGTTCTACCTGTTTGAGAATGTGGACAATGCCCAGCAGTTCAAGCAG
CTCTACCGGGCCAGGATGAACGCCCTGGACCTGAACATGAAGACCAAAGAGAGGATCGTG
GAGGAGGCCAACAAGGCTTTTGAGTATAACATGCAGATATTCAATGAACTGGACCAGGCC
GGCTCCACACTGGCCAGAGAGACCTTGGAGGATGGGTTCCCTGTACACGATGGGAAAGGA
GACATGCGTAAATGCCCTTTCTACGCTGCTGAACAAGACAAAGGTGCCCTGGAGGGCAGC
AGCTGTCCCTTCCGAACAGCTATGGCTGTGCTGAGGAAGCCCAGCCTCCAGTTCATCCTG
GCCGCTGGTGTGGCCCTAGCTGCTGGACTCTTGGCCTGGTACTACATG
Restriction Sites Please inquire     
ACCN NM_001127206
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001127206.1, NP_001120678.1
RefSeq Size 1736 bp
RefSeq ORF 951 bp
Locus ID 3163
Cytogenetics 16p13.3
Protein Families Transmembrane
Protein Pathways Porphyrin and chlorophyll metabolism
Gene Summary 'Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]'
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 5. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 1, 2, 3, 4, 6, 7, and 8 all encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.