SLC9A3R2 (NM_001130012) Human Untagged Clone

CAT#: SC322985

SLC9A3R2 (untagged)-Human solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2 (SLC9A3R2), transcript variant 1


  "NM_001130012" in other vectors (4)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SLC9A3R2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC9A3R2
Synonyms E3KARP; NHE3RF2; NHERF-2; NHERF2; OCTS2; SIP-1; SIP1; TKA-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001130012, the custom clone sequence may differ by one or more nucleotides


ATGGCCGCGCCGGAGCCGCTGCGGCCGCGCCTGTGCCGCTTGGTGCGCGGAGAGCAGGGCTACGGCTTCC
ACCTGCACGGCGAGAAGGGCCGCCGCGGGCAGTTCATCCGGCGCGTGGAACCCGGTTCCCCCGCCGAGGC
CGCCGCGCTGCGCGCTGGGGACCGCCTGGTCGAGGTCAACGGCGTCAACGTGGAGGGCGAGACGCACCAC
CAGGTGGTGCAAAGGATCAAGGCTGTGGAGGGGCAGACTCGGCTGCTGGTGGTGGACCAGGAGACAGATG
AGGAGCTCCGCCGGCGGCAGCTGACCTGTACCGAGGAGATGGCCCAGCGAGGGCTCCCACCCGCCCACGA
CCCCTGGGAGCCGAAGCCAGACTGGGCACACACCGGCAGCCACAGCTCCGAAGCTGGCAAGAAGGATGTC
AGTGGGCCCCTGAGGGAGCTGCGCCCTCGGCTCTGCCACCTGCGAAAGGGACCTCAGGGCTATGGGTTCA
ACCTGCATAGTGACAAGTCCCGGCCCGGCCAGTACATCCGCTCTGTGGACCCGGGCTCACCTGCCGCCCG
CTCTGGCCTCCGCGCCCAGGACCGGCTCATTGAGGTGAACGGGCAGAATGTGGAGGGACTGCGCCATGCT
GAGGTGGTGGCCAGCATCAAGGCACGGGAGGACGAGGCCCGGCTGCTGGTCGTGGACCCCGAGACAGATG
AACACTTCAAGCGGCTTCGGGTCACACCCACCGAGGAGCACGTGGAAGGTCCTCTGCCGTCACCCGTCAC
CAATGGAACCAGCCCTGCCCAGCTCAATGGTGGCTCTGCGTGCTCGTCCCGAAGTGACCTGCCTGGTTCC
GACAAGGACACTGAGGATGGCAGTGCCTGGAAGCAAGATCCCTTCCAGGAGAGCGGCCTCCACCTGAGCC
CCACGGCGGCCGAGGCCAAGGAGAAGGCTCGAGCCATGCGAGTCAACAAGCGCGCGCCACAGATGGACTG
GAACAGGAAGCGTGAAATCTTCAGCAACTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001130012
ORF Size 1014 bp
Insert Size 1014
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001130012.2, NP_001123484.1
RefSeq Size 2194
RefSeq ORF 1014
Locus ID 9351
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the NHERF family of PDZ scaffolding proteins. These proteins mediate many cellular processes by binding to and regulating the membrane expression and protein-protein interactions of membrane receptors and transport proteins. The encoded protein plays a role in intestinal sodium absorption by regulating the activity of the sodium/hydrogen exchanger 3, and may also regulate the cystic fibrosis transmembrane regulator (CFTR) ion channel. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.