GALE (NM_001127621) Human Untagged Clone

CAT#: SC322994

GALE (untagged)-Human UDP-galactose-4-epimerase (GALE), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GALE
• Synonyms: SDR1E1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001127621, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGAGAAGGTGCTGGTAACAGGTGGGGCTGGCTACATTGGCAGCCACACGGTGCTGGAGCTGCTGG
  AGGCTGGCTACTTGCCTGTGGTCATCGATAACTTCCATAATGCCTTCCGTGGAGGGGGCTCCCTGCCTGA
  GAGCCTGCGGCGGGTCCAGGAGCTGACAGGCCGCTCTGTGGAGTTTGAGGAGATGGACATTTTGGACCAG
  GGAGCCCTACAGCGTCTCTTCAAAAAGTACAGCTTTATGGCGGTCATCCACTTTGCGGGGCTCAAGGCCG
  TGGGCGAGTCGGTGCAGAAGCCTCTGGATTATTACAGAGTTAACCTGACCGGGACCATCCAGCTTCTGGA
  GATCATGAAGGCCCACGGGGTGAAGAACCTGGTGTTCAGCAGCTCAGCCACTGTGTACGGGAACCCCCAG
  TACCTGCCCCTTGATGAGGCCCACCCCACGGGTGGTTGTACCAACCCTTACGGCAAGTCCAAGTTCTTCA
  TCGAGGAAATGATCCGGGACCTGTGCCAGGCAGACAAGACTTGGAACGCAGTGCTGCTGCGCTATTTCAA
  CCCCACAGGTGCCCATGCCTCTGGCTGCATTGGTGAGGATCCCCAGGGCATACCCAACAACCTCATGCCT
  TATGTCTCCCAGGTGGCGATCGGGCGACGGGAGGCCCTGAATGTCTTTGGCAATGACTATGACACAGAGG
  ATGGCACAGGTGTCCGGGATTACATCCATGTCGTGGATCTGGCCAAGGGCCACATTGCAGCCTTAAGGAA
  GCTGAAAGAACAGTGTGGCTGCCGGATCTACAACCTGGGCACGGGCACAGGCTATTCAGTGCTGCAGATG
  GTCCAGGCTATGGAGAAGGCCTCTGGGAAGAAGATCCCGTACAAGGTGGTGGCACGGCGGGAAGGTGATG
  TGGCAGCCTGTTACGCCAACCCCAGCCTGGCCCAAGAGGAGCTGGGGTGGACAGCAGCCTTAGGGCTGGA
  CAGGATGTGTGAGGATCTCTGGCGCTGGCAGAAGCAGAATCCTTCAGGCTTTGGCACGCAAGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001127621
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001127621.1, NP_001121093.1
• RefSeq Size: 1626 bp
• RefSeq ORF: 1047 bp
• Locus ID: 2582
• Cytogenetics: 1p36.11
• Protein Families: Druggable Genome
• Protein Pathways: Amino sugar and nucleotide sugar metabolism, Galactose metabolism, Metabolic pathways
• Gene Summary: 'This gene encodes UDP-galactose-4-epimerase which catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. The bifunctional nature of the enzyme has the important metabolic consequence that mutant cells (or individuals) are dependent not only on exogenous galactose, but also on exogenous N-acetylgalactosamine as a necessary precursor for the synthesis of glycoproteins and glycolipids. Mutations in this gene result in epimerase-deficiency galactosemia, also referred to as galactosemia type 3, a disease characterized by liver damage, early-onset cataracts, deafness and cognitive disability, with symptoms ranging from mild ('peripheral' form) to severe ('generalized' form). Multiple alternatively spliced transcripts encoding the same protein have been identified. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.