ASAH1 (NM_001127505) Human Untagged Clone

CAT#: SC323014

ASAH1 (untagged)-Human N-acylsphingosine amidohydrolase (acid ceramidase) 1 (ASAH1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ASAH1
• Synonyms: AC; ACDase; ASAH; PHP; PHP32; SMAPME
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001127505, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACTGCTGCATCGGGCTGGGAGAGAAAGCTCGCGGGTCCCACCGGGCCTCCTACCCAAGTCTCAGCG
  CGCTTTTCACCGAGGCCTCAATTCTGGGATTTGGCAGCTTTGCTGTGAAAGCCCAATGGACAGAGGACTG
  CAGAAAATCAACCTATCCTCCTTCAGGACCAACTGTCTTCCCTGCTGTTATAAGGTACAGAGGTGCAGTT
  CCATGGTACACCATAAATCTTGACTTACCACCCTACAAAAGATGGCATGAATTGATGCTTGACAAGGCAC
  CAGTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTTTTGAAGAGGAAATGAAGGGTATTGCCGCTGTTAC
  TGATATACCTTTAGGAGAGATTATTTCATTCAATATTTTTTATGAATTATTTACCATTTGTACTTCAATA
  GTAGCAGAAGACAAAAAAGGTCATCTAATACATGGGAGAAACATGGATTTTGGAGTATTTCTTGGGTGGA
  ACATAAATAATGATACCTGGGTCATAACTGAGCAACTAAAACCTTTAACAGTGAATTTGGATTTCCAAAG
  AAACAACAAAACTGTCTTCAAGGCTTCAAGCTTTGCTGGCTATGTGGGCATGTTAACAGGATTCAAACCA
  GGACTGTTCAGTCTTACACTGAATGAACGTTTCAGTATAAATGGTGGTTATCTGGGTATTCTAGAATGGA
  TTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGTTCTGGAAAATAGCACAAGTTA
  TGAAGAAGCCAAGAATTTATTGACCAAGACCAAGATATTGGCCCCAGCCTACTTTATCCTGGGAGGCAAC
  CAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGAATCATTGGATGTATATGAACTCGATGCTA
  AGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCG
  CAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCATTTGAAACCATGTATGAT
  GTCCTGTCAACAAAACCTGTCCTCAACAAGCTGACCGTATACACAACCTTGATAGATGTTACCAAAGGTC
  AATTCGAAACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001127505
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001127505.2, NP_001120977.1
• RefSeq Size: 2602 bp
• RefSeq ORF: 1170 bp
• Locus ID: 427
• Cytogenetics: 8p22
• Protein Families: Druggable Genome
• Protein Pathways: Lysosome, Metabolic pathways, Sphingolipid metabolism
• Gene Summary: 'This gene encodes a member of the acid ceramidase family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. Processing of this preproprotein generates alpha and beta subunits that heterodimerize to form the mature lysosomal enzyme, which catalyzes the degradation of ceramide into sphingosine and free fatty acid. This enzyme is overexpressed in multiple human cancers and may play a role in cancer progression. Mutations in this gene are associated with the lysosomal storage disorder, Farber lipogranulomatosis, and a neuromuscular disorder, spinal muscular atrophy with progressive myoclonic epilepsy. [provided by RefSeq, Oct 2015]'
  Transcript Variant: This variant (3) contains an alternate in-frame exon and lacks another alternate in-frame exon compared to variant 2. The resulting isoform (c) has the same N- and C-termini but is shorter compared to isoform b.