GABA A Receptor alpha 1 (GABRA1) (NM_001127646) Human Untagged Clone

CAT#: SC323075

GABRA1 (untagged)-Human gamma-aminobutyric acid (GABA) A receptor, alpha 1 (GABRA1), transcript variant 5


  "NM_001127646" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GABRA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GABRA1
Synonyms ECA4; EJM; EJM5
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001127646, the custom clone sequence may differ by one or more nucleotides
ATGAGGAAAAGTCCAGGTCTGTCTGACTGTCTTTGGGCCTGGATCCTCCTTCTGAGCACA
CTGACTGGAAGAAGCTATGGACAGCCGTCATTACAAGATGAACTTAAAGACAATACCACT
GTCTTCACCAGGATTTTGGACAGACTCCTAGATGGTTATGACAATCGCCTGAGACCAGGA
TTGGGAGAGCGTGTAACCGAAGTGAAGACTGATATCTTCGTCACCAGTTTCGGACCCGTT
TCAGACCATGATATGGAATATACAATAGATGTATTTTTCCGTCAAAGCTGGAAGGATGAA
AGGTTAAAATTTAAAGGACCTATGACAGTCCTCCGGTTAAATAACCTAATGGCAAGTAAA
ATCTGGACTCCGGACACATTTTTCCACAATGGAAAGAAGTCAGTGGCCCACAACATGACC
ATGCCCAACAAACTCCTGCGGATCACAGAGGATGGCACCTTGCTGTACACCATGAGGCTG
ACAGTGAGAGCTGAATGTCCGATGCATTTGGAGGACTTCCCTATGGATGCCCATGCTTGC
CCACTAAAATTTGGAAGTTATGCTTATACAAGAGCAGAAGTTGTTTATGAATGGACCAGA
GAGCCAGCACGCTCAGTGGTTGTAGCAGAAGATGGATCACGTCTAAACCAGTATGACCTT
CTTGGACAAACAGTAGACTCTGGAATTGTCCAGTCAAGTACAGGAGAATATGTTGTTATG
ACCACTCATTTCCACTTGAAGAGAAAGATTGGCTACTTTGTTATTCAAACATACCTGCCA
TGCATAATGACAGTGATTCTCTCACAAGTCTCCTTCTGGCTCAACAGAGAGTCTGTACCA
GCAAGAACTGTCTTTGGAGTAACAACTGTGCTCACCATGACAACATTGAGCATCAGTGCC
AGAAACTCCCTCCCTAAGGTGGCTTATGCAACAGCTATGGATTGGTTTATTGCCGTGTGC
TATGCCTTTGTGTTCTCAGCTCTGATTGAGTTTGCCACAGTAAACTATTTCACTAAGAGA
GGTTATGCATGGGATGGCAAAAGTGTGGTTCCAGAAAAGCCAAAGAAAGTAAAGGATCCT
CTTATTAAGAAAAACAACACTTACGCTCCAACAGCAACCAGCTACACCCCTAATTTGGCC
AGGGGCGACCCGGGCTTAGCCACCATTGCTAAAAGTGCAACCATAGAACCTAAAGAGGTC
AAGCCCGAAACAAAACCACCAGAACCCAAGAAAACCTTTAACAGTGTCAGCAAAATTGAC
CGACTGTCAAGAATAGCCTTCCCGCTGCTATTTGGAATCTTTAACTTAGTCTACTGGGCT
ACGTATTTAAACAGAGAGCCTCAGCTAAAAGCCCCCACACCACATCAA
Restriction Sites Please inquire     
ACCN NM_001127646
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001127646.1, NP_001121118.1
RefSeq Size 4067 bp
RefSeq ORF 1371 bp
Locus ID 2554
Cytogenetics 5q34
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary 'This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene cause juvenile myoclonic epilepsy and childhood absence epilepsy type 4. Multiple transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 1. Variants 1-7 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.