NR2C1 (NM_001127362) Human Untagged Clone

CAT#: SC323095

NR2C1 (untagged)-Human nuclear receptor subfamily 2, group C, member 1 (NR2C1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NR2C1
• Synonyms: TR2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001127362, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAACCATAGAAGAAATTGCACATCAAATTATTGAACAACAGATGGGAGAGATTGTTACAGAGCAGC
  AAACTGGGCAGAAAATCCAGATTGTGACAGCACTTGATCATAATACCCAAGGCAAGCAGTTCATTCTGAC
  AAATCACGACGGCTCTACTCCAAGCAAAGTCATTCTGGCCAGGCAAGATTCCACTCCGGGAAAAGTTTTC
  CTTACAACTCCAGATGCAGCAGGTGTCAACCAGTTATTTTTTACCACTCCTGATCTGTCTGCACAACACC
  TGCAGCTCCTAACAGATAATTCTCCAGACCAAGGACCAAATAAGGTTTTTGATCTTTGCGTAGTATGTGG
  AGACAAAGCATCAGGACGTCATTATGGAGCAGTAACTTGTGAAGGCTGCAAAGGATTTTTTAAAAGAAGC
  ATCCGAAAAAATTTAGTATATTCATGTCGAGGATCAAAGGATTGTATTATTAATAAGCACCACCGAAACC
  GCTGTCAATACTGCAGGTTACAGAGATGTATTGCGTTTGGAATGAAGCAAGACTCTGTCCAATGTGAAAG
  AAAACCCATTGAAGTATCACGAGAAAAATCTTCCAACTGTGCCGCTTCAACAGAAAAAATCTATATCCGA
  AAGGACCTTCGTAGCCCATTAACTGCAACTCCAACTTTTGTAACAGATAGTGAAAGTACAAGGTCAACAG
  GACTGTTAGATTCAGGAATGTTCATGAATATTCATCCATCTGGAGTAAAAACTGAGTCAGCTGTGCTGAT
  GACATCAGATAAGGCTGAATCATGTCAGGGAGATTTAAGTACATTGGCCAATGTGGTTACATCATTAGCG
  AATCTTGGAAAAACTAAAGATCTTTCTCAAAATAGTAATGAAATGTCTATGATTGAAAGCTTAAGCAATG
  ATGATACCTCTTTGTGTGAATTTCAAGAAATGCAGACCAACGGTGATGTTTCAAGGGCATTTGACACTCT
  TGCAAAAGCATTGAATCCTGGAGAGAGCACAGCCTGCCAGAGCTCAGTAGCGGGCATGGAAGGAAGTGTA
  CACCTAATCACTGGAGATTCAAGCATAAATTACACCGAAAAAGAGGGGCCACTTCTCAGCGATTCACATG
  TAGCTTTCAGGCTCACCATGCCTTCTCCTATGCCTGAGTACCTGAATGTGCACTACATTGGGGAGTCTGC
  CTCCAGACTGCTGTTCTTATCAATGCACTGGGCACTTTCGATTCCTTCTTTCCAGGCTCTAGGGCAAGAA
  AACAGCATATCACTGGTGAAAGCTTACTGGAATGAACTTTTTACTCTTGGTCTTGCCCAGTGCTGGCAAG
  TGATGAATGTAGCAACTATATTAGCAACATTTGTCAATTGTCTTCACAATAGTCTTCAACAAGATGCCAA
  GGTAATTGCAGCCCTCATTCATTTCACAAGACGAGCAATCACTGATTTATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001127362
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001127362.1, NP_001120834.1
• RefSeq Size: 2147 bp
• RefSeq ORF: 1452 bp
• Locus ID: 7181
• Cytogenetics: 12q22
• Protein Families: Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
• Gene Summary: 'This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR compared to variant 1. The resulting isoform (c, also known as TR2-5) has a shorter C-terminus compared to isoform a.