PAK1 (NM_001128620) Human Untagged Clone

CAT#: SC323136

PAK1 (untagged)-Human p21 protein (Cdc42/Rac)-activated kinase 1 (PAK1), transcript variant 1


  "NM_001128620" in other vectors (6)

Reconstitution Protocol

USD 930.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "PAK1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PAK1
Synonyms IDDMSSD; PAKalpha
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001128620 edited
ATGTCAAATAACGGCCTAGACATTCAAGACAAACCCCCAGCCCCTCCGATGAGAAATACC
AGCACTATGATTGGAGCCGGCAGCAAAGATGCTGGAACCCTAAACCATGGTTCTAAACCT
CTGCCTCCAAACCCAGAGGAGAAGAAAAAGAAGGACCGATTTTACCGATCCATTTTACCT
GGAGATAAAACAAATAAAAAGAAAGAGAAAGAGCGGCCAGAGATTTCTCTCCCTTCAGAT
TTTGAACACACAATTCATGTCGGTTTTGATGCTGTCACAGGGGAGTTTACGGGAATGCCA
GAGCAGTGGGCCCGCTTGCTTCAGACATCAAATATCACTAAGTCGGAGCAGAAGAAAAAC
CCGCAGGCTGTTCTGGATGTGTTGGAGTTTTACAACTCGAAGAAGACATCCAACAGCCAG
AAATACATGAGCTTTACAGATAAGTCAGCTGAGGATTACAATTCTTCTAATGCCTTGAAT
GTGAAGGCTGTGTCTGAGACTCCTGCAGTGCCACCAGTTTCAGAAGATGAGGATGATGAT
GATGATGATGCTACCCCACCACCAGTGATTGCTCCACGCCCAGAGCACACAAAATCTGTA
TACACACGGTCTGTGATTGAACCACTTCCTGTCACTCCAACTCGGGACGTGGCTACATCT
CCCATTTCACCTACTGAAAATAACACCACTCCACCAGATGCTTTGACCCGGAATACTGAG
AAGCAGAAGAAGAAGCCTAAAATGTCTGATGAGGAGATCTTGGAGAAATTACGAAGCATA
GTGAGTGTGGGCGATCCTAAGAAGAAATATACACGGTTTGAGAAGATTGGACAAGGTGCT
TCAGGCACCGTGTACACAGCAATGGATGTGGCCACAGGACAGGAGGTGGCCATTAAGCAG
ATGAATCTTCAGCAGCAGCCCAAGAAAGAGCTGATTATTAATGAGATCCTGGTCATGAGG
GAAAACAAGAACCCAAACATTGTGAATTACTTGGACAGTTACCTCGTGGGAGATGAGCTG
TGGGTTGTTATGGAATACTTGGCTGGAGGCTCCTTGACAGATGTGGTGACAGAAACTTGC
ATGGATGAAGGCCAAATTGCAGCTGTGTGCCGTGAGTGTCTGCAGGCTCTGGAGTTCTTG
CATTCGAACCAGGTCATTCACAGAGACATCAAGAGTGACAATATTCTGTTGGGAATGGAT
GGCTCTGTCAAGCTAACTGACTTTGGATTCTGTGCACAGATAACCCCAGAGCAGAGCAAA
CGGAGCACCATGGTAGGAACCCCATACTGGATGGCACCAGAGGTTGTGACACGAAAGGCC
TATGGGCCCAAGGTTGACATCTGGTCCCTGGGCATCATGGCCATCGAAATGATTGAAGGG
GAGCCTCCATACCTCAATGAAAACCCTCTGAGAGCCTTGTACCTCATTGCCACCAATGGG
ACCCCAGAACTTCAGAACCCAGAGAAGCTGTCAGCTATCTTCCGGGACTTTCTGAACCGC
TGTCTCGAGATGGATGTGGAGAAGAGAGGTTCAGCTAAAGAGCTGCTACAGGTGAGAAAA
CTGAGGTTTCAAGTGTTTAGTAACTTTTCCATGATAGCTGCATCAATTCCTGAAGATTGC
CAAGCCCCTCTCCAGCCTCACTCCACTGATTGCTGCAGCTAA
Restriction Sites Please inquire     
ACCN NM_001128620
Insert Size 1700 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001128620.1, NP_001122092.1
RefSeq Size 3484 bp
RefSeq ORF 1662 bp
Locus ID 5058
Cytogenetics 11q13.5-q14.1
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
Protein Pathways Axon guidance, Chemokine signaling pathway, Epithelial cell signaling in Helicobacter pylori infection, ErbB signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway
Gene Summary 'This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Mutations in this gene have been associated with macrocephaly, seizures, and speech delay. Overexpression of this gene is also reported in many cancer types, and particularly in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2020]'
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.