p73 (TP73) (NM_001126240) Human Untagged Clone

CAT#: SC323148

TP73 (untagged)-Human tumor protein p73 (TP73), transcript variant 2


  "NM_001126240" in other vectors (4)

Reconstitution Protocol

USD 1,000.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TP73"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TP73
Synonyms P73
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001126240, the custom clone sequence may differ by one or more nucleotides
ATGCTGTACGTCGGTGACCCCGCACGGCACCTCGCCACGGCCCAGTTCAATCTGCTGAGC
AGCACCATGGACCAGATGAGCAGCCGCGCGGCCTCGGCCAGCCCCTACACCCCAGAGCAC
GCCGCCAGCGTGCCCACCCACTCGCCCTACGCACAACCCAGCTCCACCTTCGACACCATG
TCGCCGGCGCCTGTCATCCCCTCCAACACCGACTACCCCGGACCCCACCACTTTGAGGTC
ACTTTCCAGCAGTCCAGCACGGCCAAGTCAGCCACCTGGACGTACTCCCCGCTCTTGAAG
AAACTCTACTGCCAGATCGCCAAGACATGCCCCATCCAGATCAAGGTGTCCACCCCGCCA
CCCCCAGGCACCGCCATCCGGGCCATGCCTGTTTACAAGAAAGCGGAGCACGTGACCGAC
GTCGTGAAACGCTGCCCCAACCACGAGCTCGGGAGGGACTTCAACGAAGGACAGTCTGCT
CCAGCCAGCCACCTCATCCGCGTGGAAGGCAATAATCTCTCGCAGTATGTGGATGACCCT
GTCACCGGCAGGCAGAGCGTCGTGGTGCCCTATGAGCCACCACAGGTGGGGACGGAATTC
ACCACCATCCTGTACAACTTCATGTGTAACAGCAGCTGTGTAGGGGGCATGAACCGGCGG
CCCATCCTCATCATCATCACCCTGGAGATGCGGGATGGGCAGGTGCTGGGCCGCCGGTCC
TTTGAGGGCCGCATCTGCGCCTGTCCTGGCCGCGACCGAAAAGCTGATGAGGACCACTAC
CGGGAGCAGCAGGCCCTGAACGAGAGCTCCGCCAAGAACGGGGCCGCCAGCAAGCGTGCC
TTCAAGCAGAGCCCCCCTGCCGTCCCCGCCCTTGGTGCCGGTGTGAAGAAGCGGCGGCAT
GGAGACGAGGACACGTACTACCTTCAGGTGCGAGGCCGGGAGAACTTTGAGATCCTGATG
AAGCTGAAAGAGAGCCTGGAGCTGATGGAGTTGGTGCCGCAGCCACTGGTGGACTCCTAT
CGGCAGCAGCAGCAGCTCCTACAGAGGCCGAGTCACCTACAGCCCCCGTCCTACGGGCCG
GTCCTCTCGCCCATGAACAAGGTGCACGGGGGCATGAACAAGCTGCCCTCCGTCAACCAG
CTGGTGGGCCAGCCTCCCCCGCACAGTTCGGCAGCTACACCCAACCTGGGGCCCGTGGGC
CCCGGGATGCTCAACAACCATGGCCACGCAGTGCCAGCCAACGGCGAGATGAGCAGCAGC
CACAGCGCCCAGTCCATGGTCTCGGGGTCCCACTGCACTCCGCCACCCCCCTACCACGCC
GACCCCAGCCTCGTCAGTTTTTTAACAGGATTGGGGTGTCCAAACTGCATCGAGTATTTC
ACCTCCCAAGGGTTACAGAGCATTTACCACCTGCAGAACCTGACCATTGAGGACCTGGGG
GCCCTGAAGATCCCCGAGCAGTACCGCATGACCATCTGGCGGGGCCTGCAGGACCTGAAG
CAGGGCCACGACTACAGCACCGCGCAGCAGCTGCTCCGCTCTAGCAACGCGGCCACCATC
TCCATCGGCGGCTCAGGGGAACTGCAGCGCCAGCGGGTCATGGAGGCCGTGCACTTCCGC
GTGCGCCACACCATCACCATCCCCAACCGCGGCGGCCCAGGCGGCGGCCCTGACGAGTGG
GCGGACTTCGGCTTCGACCTGCCCGACTGCAAGGCCCGCAAGCAGCCCATCAAGGAGGAG
TTCACGGAGGCCGAGATCCAC
Restriction Sites Please inquire     
ACCN NM_001126240
Insert Size 2800 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001126240.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001126240.1, NP_001119712.1
RefSeq Size 2822 bp
RefSeq ORF 1764 bp
Locus ID 7161
Cytogenetics 1p36.32
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Neurotrophin signaling pathway, p53 signaling pathway
Gene Summary 'This gene encodes a member of the p53 family of transcription factors involved in cellular responses to stress and development. It maps to a region on chromosome 1p36 that is frequently deleted in neuroblastoma and other tumors, and thought to contain multiple tumor suppressor genes. The demonstration that this gene is monoallelically expressed (likely from the maternal allele), supports the notion that it is a candidate gene for neuroblastoma. Many transcript variants resulting from alternative splicing and/or use of alternate promoters have been found for this gene, but the biological validity and the full-length nature of some variants have not been determined. [provided by RefSeq, Feb 2011]'
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b, also known as deltaN p73 alpha) has a shorter and distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.