CDK6 (NM_001259) Human Untagged Clone

CAT#: SC323496

CDK6 (untagged)-Kinase deficient mutant (K43M) of Human cyclin-dependent kinase 6 (CDK6)


  "NM_001259" in other vectors (7)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CDK6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDK6
Synonyms MCPH12; PLSTIRE
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001259, the custom clone sequence may differ by one or more nucleotides


ATGGAGAAGGACGGCCTGTGCCGCGCTGACCAGCAGTACGAATGCGTGGCGGAGATCGGGGAGGGCGCCT
ATGGGAAGGTGTTCAAGGCCCGCGACTTGAAGAACGGAGGCCGTTTCGTGGCGTTGAAGCGCGTGCGGGT
GCAGACCGGCGAGGAGGGCATGCCGCTCTCCACCATCCGCGAGGTGGCGGTGCTGAGGCACCTGGAGACC
TTCGAGCACCCCAACGTGGTCAGGTTGTTTGATGTGTGCACAGTGTCACGAACAGACAGAGAAACCAAAC
TAACTTTAGTGTTTGAACATGTCGATCAAGACTTGACCACTTACTTGGATAAAGTTCCAGAGCCTGGAGT
GCCCACTGAAACCATAAAGGATATGATGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGA
GTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAACTCGCTGACT
TCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTCGTCACGCTGTGGTACAGAGC
ACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTGGATCTCTGGAGTGTTGGCTGCATATTTGCA
GAAATGTTTCGTAGAAAGCCTCTTTTTCGTGGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACG
TGATTGGACTCCCAGGAGAAGAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAA
ATCTGCCCAACCAATTGAGAAGTTTGTAACAGATATCGATGAACTAGGCAAAGACCTACTTCTGAAGTGT
TTGACATTTAACCCAGCCAAAAGAATATCTGCCTACAGTGCCCTGTCTCACCCATACTTCCAGGACCTGG
AAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGAACACCTCGGAGCTGAATACAGCCTG
A


>OriGene 5' read for mutant NM_001259 unedited
CCCGCCGTTGAGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAA
CCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGGCTTCAGCCCTGC
AGGGAAAGAAAAGTGCAATGATTCTGGACTGAGACGCGCTTGGGCAGAGGCTATGTAATCGTGTCTGTGT
TGAGGACTTCGCTTCGAGGAGGGAAGAGGAGGGATCGGCTCGCTCCTCCGGCGGCGGCGGCGGCGGCGAC
TCTGCAGGCGGAGTTTCGCGGCGGCGGCACCAGGGTTACGCCAGCCCCCGCGGGGAGGTCCTCTCCATCC
AGCTTCTGCAGCGGCGAAAAGCCCCCAGCGCCCGAGCCGCCTGGAGCCCGGGCGGGGGAGCAAAGTAAAG
CTAGACCGATCCTCCGGGGGAGCCCCGGAGTAGGCAAGCCGGCGGCCGCCAGCAAGTTGAGCGCCCCCCC
GCCGCCCAACGGCCGCCGGGCGGGGGGCGTCAAGCGGATGAAAAGGACGGCTTGCCCGCCTACCACATAC
ATGCTTGCGAAATCGGAGGGCCCATGAAGTGTCAGGCCGACTGAAACGAGCCGTCAGCCTTGAGCGCGGG
GGTAACCAGACGCGCA
>SC323496 kinase domain raw sequence. By performing BLASTX analysis with this sequence against NCBI refernce protein database, you can confirm the presence of the kinase-deficient mutation
TYKRCYSMWAARWWMGGYKAAGAGTCKATGCGTGGCGGAGATCGGGGAGGGCGCCTATGGGAAGGTGTTC
AAGGCCCGCGACTTGAAGAACGGAGGCCGTTTCGTGGCGTTGATGCGCGTGCGTGGCGTTGATGCGCGTG
CGTGGCGTTGATGCGCGTGCGTGGCGTTGATGCGGGTGCGTGGCGTTGATGCGCGTGCGTGGCGTTGATG
CGCGTGCGTGGCGTTGATGCGCGTGCGTGGCGTTGATGCGCGTGC
Restriction Sites Please inquire     
ACCN NM_001259
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001259.5, NP_001250.1
RefSeq Size 11611 bp
RefSeq ORF 981 bp
Locus ID 1021
Cytogenetics 7q21.2
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Cell cycle, Chronic myeloid leukemia, Glioma, Melanoma, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Pathways in cancer, Small cell lung cancer
Gene Summary 'The protein encoded by this gene is a member of the CMGC family of serine/threonine protein kinases. This kinase is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression and G1/S transition. The activity of this kinase first appears in mid-G1 phase, which is controlled by the regulatory subunits including D-type cyclins and members of INK4 family of CDK inhibitors. This kinase, as well as CDK4, has been shown to phosphorylate, and thus regulate the activity of, tumor suppressor protein Rb. Altered expression of this gene has been observed in multiple human cancers. A mutation in this gene resulting in reduced cell proliferation, and impaired cell motility and polarity, and has been identified in patients with primary microcephaly. [provided by RefSeq, Aug 2017]'
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.