IDH3G (NM_004135) Human Untagged Clone
CAT#: SC323781
IDH3G (untagged)-Human isocitrate dehydrogenase 3 (NAD+) gamma (IDH3G), nuclear gene encoding mitochondrial protein, transcript variant 1
"NM_004135" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IDH3G |
Synonyms | H-IDHG |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004135.2
GGTATCTGCGTGTCGGGACGTGCGGAGGCTCTCACTTTCCGTCATGGCGCTGAAGGTAGC
GACCGTCGCCGGCAGCGCCGCGAAGGCGGTGCTCGGGCCAGCCCTTCTCTGCCGTCCCTG GGAGGTTCTAGGCGCCCACGAGGTCCCCTCGAGGAACATCTTTTCAGAACAAACAATTCC TCCGTCCGCTAAGTATGGCGGGCGGCACACGGTGACCATGATCCCAGGGGATGGCATCGG GCCAGAGCTCATGCTGCATGTCAAGTCCGTCTTCAGGCACGCATGTGTACCAGTGGACTT TGAAGAGGTGCACGTGAGTTCCAATGCTGATGAAGAGGACATTCGCAATGCCATCATGGC CATCCGCCGGAACCGCGTGGCCCTGAAGGGCAACATCGAAACCAACCATAACCTGCCACC GTCGCACAAATCTCGAAACAACATCCTTCGCACCAGCCTGGACCTCTATGCCAACGTCAT CCACTGTAAGAGCCTTCCAGGCGTGGTGACCCGGCACAAGGACATAGACATCCTCATTGT CCGGGAGAACACAGAGGGCGAGTACAGCAGCCTGGAGCATGAGAGTGTGGCGGGAGTGGT GGAGAGCCTGAAGATCATCACCAAGGCCAAGTCCCTGCGCATTGCCGAGTATGCCTTCAA GCTGGCGCAGGAGAGCGGGCGCAAGAAAGTGACGGCCGTGCACAAGGCCAACATCATGAA ACTGGGCGATGGGCTTTTCCTCCAGTGCTGCAGGGAGGTGGCAGCCCGCTACCCTCAGAT CACCTTCGAGAACATGATTGTGGATAACACCACCATGCAGCTGGTGTCCCGGCCCCAGCA GTTTGATGTCATGGTGATGCCCAATCTCTATGGCAACATCGTCAACAATGTCTGCGCGGG ACTGGTCGGGGGCCCAGGCCTTGTGGCTGGGGCCAACTATGGCCATGTGTACGCGGTGTT TGAAACAGCTACGAGGAACACCGGCAAGAGTATCGCCAATAAGAACATCGCCAACCCCAC GGCCACCCTGCTGGCCAGCTGCATGATGCTGGACCACCTCAAGCTGCACTCCTATGCCAC CTCCATCCGTAAGGCTGTCCTGGCATCCATGGACAATGAGAATATGCACACTCCGGACAT CGGGGGCCAGGGCACAACATCTGAAGCCATCCAGGACGTCATCCGCCACATCCGCGTCAT CAACGGCCGGGCCGTGGAGGCCTAGGCTGGCCCTAGGACCTTCTTGGTTTGCTCCTTGGA TTCCCCTTCCCACTCCAGCACCCCAGCCAGCCTGGTACGCAGATCCCAGAATAAAGCACC TTCTCCCTAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_004135 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004135.2, NP_004126.1 |
RefSeq Size | 1500 bp |
RefSeq ORF | 1182 bp |
Locus ID | 3421 |
Cytogenetics | Xq28 |
Domains | isodh |
Protein Pathways | Citrate cycle (TCA cycle), Metabolic pathways |
Gene Summary | 'Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the gamma subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. This gene is a candidate gene for periventricular heterotopia. Several alternatively spliced transcript variants of this gene have been described, but only some of their full length natures have been determined. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC111641 | IDH3G (untagged)-Human isocitrate dehydrogenase 3 (NAD+) gamma (IDH3G), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 310.00 |
|
RC201692 | IDH3G (Myc-DDK-tagged)-Human isocitrate dehydrogenase 3 (NAD+) gamma (IDH3G), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 420.00 |
|
RG201692 | IDH3G (GFP-tagged) - Human isocitrate dehydrogenase 3 (NAD+) gamma (IDH3G), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 460.00 |
|
RC201692L1 | Lenti ORF clone of Human isocitrate dehydrogenase 3 (NAD+) gamma (IDH3G), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC201692L2 | Lenti ORF clone of Human isocitrate dehydrogenase 3 (NAD+) gamma (IDH3G), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC201692L3 | Lenti ORF clone of Human isocitrate dehydrogenase 3 (NAD+) gamma (IDH3G), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC201692L4 | Lenti ORF clone of Human isocitrate dehydrogenase 3 (NAD+) gamma (IDH3G), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review