Spasmolytic Polypeptide (TFF2) (NM_005423) Human Untagged Clone

CAT#: SC323966

TFF2 (untagged)-Human trefoil factor 2 (TFF2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TFF2
• Synonyms: SML1; SP
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_005423.3 TGGGGTGCAGCTGAGCTAGACATGGGACGGCGAGACGCCCAGCTCCTGGCAGCGCTCCTC
  GTCCTGGGGCTATGTGCCCTGGCGGGGAGTGAGAAACCCTCCCCCTGCCAGTGCTCCAGG
  CTGAGCCCCCATAACAGGACGAACTGCGGCTTCCCTGGAATCACCAGTGACCAGTGTTTT
  GACAATGGATGCTGTTTCGACTCCAGTGTCACTGGGGTCCCCTGGTGTTTCCACCCCCTC
  CCAAAGCAAGAGTCGGATCAGTGCGTCATGGAGGTCTCAGACCGAAGAAACTGTGGCTAC
  CCGGGCATCAGCCCCGAGGAATGCGCCTCTCGGAAGTGCTGCTTCTCCAACTTCATCTTT
  GAAGTGCCCTGGTGCTTCTTCCCGAAGTCTGTGGAAGACTGCCATTACTAAGAGAGGCTG
  GTTCCAGAGGATGCATCTGGCTCACCGGGTGTTCCGAAACCAAAGAAGAAACTTCGCCTT
  ATCAGCTTCATACTTCATGAAATCCTGGGTTTTCTTAACCATCTTTTCCTCATTTTCAAT
  GGTTTAACATATAATTTCTTTAAATAAAACCCTTAAAATCTGCAAAAAAAAAAAAAAAAA
  AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: ECoRI-NOT
• ACCN: NM_005423
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005423.3, NP_005414.1
• RefSeq Size: 616 bp
• RefSeq ORF: 390 bp
• Locus ID: 7032
• Cytogenetics: 21q22.3
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. The encoded protein inhibits gastric acid secretion. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]'