Nucleophosmin (NPM1) (NM_199185) Human Untagged Clone
CAT#: SC324072
NPM1 (untagged)-Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 2
"NM_199185" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NPM1 |
Synonyms | B23; NPM |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_199185.2
CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGTGTGATTCCGTCCTGCGCGGTTGT
TCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGCCTTCTCTCCTACCTAAGTGCGTGCCGC CACCCGATGGAAGATTCGATGGACATGGACATGAGCCCCCTGAGGCCCCAGAACTATCTT TTCGGTTGTGAACTAAAGGCCGACAAAGATTATCACTTTAAGGTGGATAATGATGAAAAT GAGCACCAGTTATCTTTAAGAACGGTCAGTTTAGGGGCTGGTGCAAAGGATGAGTTGCAC ATTGTTGAAGCAGAGGCAATGAATTACGAAGGCAGTCCAATTAAAGTAACACTGGCAACT TTGAAAATGTCTGTACAGCCAACGGTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTG GTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAGCT GTGGAGGAAGATGCAGAGTCAGAAGATGAAGAGGAGGAGGATGTGAAACTCTTAAGTATA TCTGGAAAGCGGTCTGCCCCTGGAGGTGGTAGCAAGGTTCCACAGAAAAAAGTAAAACTT GCTGCTGATGAAGATGATGACGATGATGATGAAGAGGATGATGATGAAGATGATGATGAT GATGATTTTGATGATGAGGAAGCTGAAGAAAAAGCGCCAGTGAAGAAAGGACAAGAATCC TTCAAGAAACAGGAAAAAACTCCTAAAACACCAAAAGGACCTAGTTCTGTAGAAGACATT AAAGCAAAAATGCAAGCAAGTATAGAAAAAGGTGGTTCTCTTCCCAAAGTGGAAGCCAAA TTCATCAATTATGTGAAGAATTGCTTCCGGATGACTGACCAAGAGGCTATTCAAGATCTC TGGCAGTGGAGGAAGTCTCTTTAAGAAAATAGTTTAAACAATTTGTTAAAAAATTTTCCG TCTTATTTCATTTCTGTAACAGTTGATATCTGGCTGTCCTTTTTATAATGCAGAGTGAGA ACTTTCCCTACCGTGTTTGATAAATGTTGTCCAGGTTCTATTGCCAAGAATGTGTTGTCC AAAATGCCGTTTAGTTTTTAAAGATGGAACTCCACCCTTTGCTTGGTTTTAAGTATGTAT GGAATGTTATGATAGGACATAGTAGTAGCGGTGGTCAGACATGGAAATGGTGGGGAGACA AAAATATACATGTGAAATAAAACTCAGTATTTTAATAAAGTAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_199185 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_199185.2, NP_954654.1 |
RefSeq Size | 1286 bp |
RefSeq ORF | 798 bp |
Locus ID | 4869 |
Cytogenetics | 5q35.1 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
Gene Summary | 'The protein encoded by this gene is involved in several cellular processes, including centrosome duplication, protein chaperoning, and cell proliferation. The encoded phosphoprotein shuttles between the nucleolus, nucleus, and cytoplasm, chaperoning ribosomal proteins and core histones from the nucleus to the cytoplasm. This protein is also known to sequester the tumor suppressor ARF in the nucleolus, protecting it from degradation until it is needed. Mutations in this gene are associated with acute myeloid leukemia. Dozens of pseudogenes of this gene have been identified. [provided by RefSeq, Aug 2017]' Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2) that lacks an internal segment, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203841 | NPM1 (Myc-DDK-tagged)-Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 2 |
USD 98.00 |
|
RG203841 | NPM1 (GFP-tagged) - Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 2 |
USD 460.00 |
|
RC203841L3 | Lenti ORF clone of Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC203841L4 | Lenti ORF clone of Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review