EVI2A (NM_014210) Human Untagged Clone
CAT#: SC324308
EVI2A (untagged)-Human ecotropic viral integration site 2A (EVI2A), transcript variant 2
"NM_014210" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EVI2A |
Synonyms | EVDA; EVI-2A; EVI2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_014210.2
CTAGCTGCACATATCCTTTTTTACTGCAGATTTACTTTAAGGCTCATATTCTCCAAGTCT
ATTCTGCTTTAAAAAGAAGACAAGAAAAGAAGTGGTTTATCAAAATCACGTTATAATCAG ATTTTGACCAAGCATTTTGTAAGATTGCCAAGCATGCCCACGGACATGGAACACACAGGA CATTACCTACATCTTGCCTTTCTGATGACAACAGTTTTTTCTTTGTCTCCTGGAACAAAA GCAAACTATACCCGTCTGTGGGCTAACAGTACTTCTTCCTGGGATTCAGTTATTCAAAAC AAGACAGGCAGAAACCAAAATGAAAACATTAACACAAACCCTATAACTCCTGAAGTAGAT TATAAAGGTAATTCTACAAACATGCCTGAAACATCTCACATCGTAGCTTTAACTTCTAAA TCTGAACAGGAGCTTTATATACCTTCTGTCGTCAGCAACAGTCCTTCAACAGTACAGAGC ATTGAAAACACAAGCAAAAGTCATGGTGAAATTTTCAAAAAGGATGTCTGTGCGGAAAAC AACAACAACATGGCTATGCTAATTTGCTTAATTATAATTGCAGTGCTTTTTCTTATCTGT ACCTTTCTATTTCTATCAACTGTGGTTTTGGCAAACAAAGTCTCTTCTCTCAGACGATCA AAACAAGTAGGCAAGCGTCAGCCTAGAAGCAATGGCGATTTTCTGGCAAGCGGTCTATGG CCCGCTGAATCAGACACTTGGAAAAGAACAAAACAGCTCACAGGACCCAACCTAGTGATG CAATCTACTGGAGTGCTCACAGCTACAAGGGAAAGAAAAGATGAAGAAGGAACTGAAAAA CTTACTAACAAACAGATAGGTTAGTGAAGAAAAATGCAAAGTAGCAATGAGAAGGCTTAT GGAGTAAAAATGAAGTCAGTTGGTATTTAATCCCAAAGTGTTGTTCTGATTATCTAAAAT TTGACATGGTAGACCTTGCAATTTAGAATCAAGCAGGTGAGACAGGGAGAAGTATGCCTG CTTAATTATTTAAACTGTGTACTTTTGTTTTGACACTGAATATTTTAAAAAGCAAATAAT AAAATAACTAAGCATTTGAGGAAAATTTTAAGGATAAATTGAGGAAACTGATTAATAGAG ATAGCAAGGGATAATTAAATAAATATTCCCTATGTAGCAACAGTGGTTAGATGATCTTTG TCTGAATGTAATTAAACTTTGAATAGTTTTAGTGTGTCCTTAAAGCCAAGTATATGCTTT AACATCAAATGGAAGTCAAATTCCTAATGCATAGATAGAGAGAGCTAAACTGTGTAATTT AATGGTATCTTCCTTGCTGGATGTGGCAGAATCCACACCAGCTTATCAACCAACACAGCT AATTTTAGAATAGATCCTTTATCTTTCCATATGGCACACGTAAGAAAGTGTTTTTCTACT ATTAATATTAAATTAAAACCTTTACTTTTGTATAATAAATTAAAACTCAGAATAAACCTG TGACCACGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_014210 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014210.2, NP_055025.2 |
RefSeq Size | 1622 bp |
RefSeq ORF | 711 bp |
Locus ID | 2123 |
Cytogenetics | 17q11.2 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | '' Transcript Variant: This variant (2) lacks a portion of the 5' UTR and 5' coding region, and uses a downstream translational start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS representation uses the 5'-most in-frame start codon, which is conserved in higher primates. An alternative downstream start codon, which is more widely conserved and has a stronger Kozak signal, also exists. It is possible that leaky scanning by ribosomes would allow the downstream start codon to be used, at least some of the time. The use of the downstream start codon would result in a protein that is 4 aa shorter at the N-terminus. Both the longer and shorter N-termini have predicted signal peptides according to SignalP 3.0. There is no experimental evidence showing which start codon is preferentially used in vivo. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC115133 | EVI2A (untagged)-Human ecotropic viral integration site 2A (EVI2A), transcript variant 2 |
USD 310.00 |
|
RC207538 | EVI2A (Myc-DDK-tagged)-Human ecotropic viral integration site 2A (EVI2A), transcript variant 2 |
USD 98.00 |
|
RG207538 | EVI2A (GFP-tagged) - Human ecotropic viral integration site 2A (EVI2A), transcript variant 2 |
USD 460.00 |
|
RC207538L3 | Lenti ORF clone of Human ecotropic viral integration site 2A (EVI2A), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC207538L4 | Lenti ORF clone of Human ecotropic viral integration site 2A (EVI2A), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review