ATP5F1D (NM_001001975) Human Untagged Clone

CAT#: SC324385

ATP5D (untagged)-Human ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit (ATP5D), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP5F1D
• Synonyms: ATP5D; MC5DN5
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001001975.1 CAGACGTCCCTGCGCGTCGTCCTCCTCGCCCTCCAGGCCGCCCGCGCCGCGCCGGAGTCC
  GCTGTCCGCCAGCTACCCGCTTCCTGCCGCCCGCCGCTGCCATGCTGCCCGCCGCGCTGC
  TCCGCCGCCCGGGACTTGGCCGCCTCGTCCGCCACGCCCGTGCCTATGCCGAGGCCGCCG
  CCGCCCCGGCTGCCGCCTCTGGCCCCAACCAGATGTCCTTCACCTTCGCCTCTCCCACGC
  AGGTGTTCTTCAACGGTGCCAACGTCCGGCAGGTGGACGTGCCCACGCTGACCGGAGCCT
  TCGGCATCCTGGCGGCCCACGTGCCCACGCTGCAGGTCCTGCGGCCGGGGCTGGTCGTGG
  TGCATGCAGAGGACGGCACCACCTCCAAATACTTTGTGAGCAGCGGTTCCATCGCAGTGA
  ACGCCGACTCTTCGGTGCAGTTGTTGGCCGAAGAGGCCGTGACGCTGGACATGTTGGACC
  TGGGGGCAGCCAAGGCAAACTTGGAGAAGGCCCAGGCGGAGCTGGTGGGGACAGCTGACG
  AGGCCACGCGGGCAGAGATCCAGATCCGAATCGAGGCCAACGAGGCCCTGGTGAAGGCCC
  TGGAGTAGGCGGTGCGTACCCGGTGTCCCGAGGCCCGGCCAGGGGCTGGGCAGGGATGCC
  AGGTGGGCCCAGCCAGCTCCTGGGGTCCCCGCCACCTGGGGAAGCCGCGCCTGCCAAGGA
  GGCCACCAGAGGGCAGTGCAGGCTTCTGCCTGGGCCCCAGGCCCTGCCTGTGTTGAAAGC
  TCTGGGGACTGGGCCAGGGAAGCTCCTCCTCAGCTTTGAGCTGTGGCTGCCACCCATGGG
  GCTCTCCTTCCGCCTCTCAAGATCCCCCCAGCCTGACGGGCCGCTTACCATCCCCTCTGC
  CCTGCAGAGCCAGCCGCCAAGGTTGACCTCAGCTTCGGAGCCACCTCTGGATGAACTGCC
  CCCAGCCCCCGCCCCATTAAAGACCCGGAAGCCTGAAAAAAAAAAAAAAAAAAAAAAAAA
  AAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_001001975
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001001975.1, NP_001001975.1
• RefSeq Size: 709 bp
• RefSeq ORF: 507 bp
• Locus ID: 513
• Cytogenetics: 19p13.3
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: 'This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the delta subunit of the catalytic core. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) lacks a segment in the 3' UTR, compared to variant 1. Both variants encode the same isoform.