RAP1A (NM_001010935) Human Untagged Clone
CAT#: SC324465
RAP1A (untagged)-Human RAP1A, member of RAS oncogene family (RAP1A), transcript variant 1
"NM_001010935" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAP1A |
Synonyms | C21KG; G-22K; KREV-1; KREV1; RAP1; SMGP21 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001010935.1
AGGCGCCGGACCGGGGGGATCGTCAGTATTTAAACAGATCACATCATGCGTGAGTACAAG
CTAGTGGTCCTTGGTTCAGGAGGCGTTGGGAAGTCTGCTCTGACAGTTCAGTTTGTTCAG GGAATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCCTACAGAAAGCAAGTTGAA GTCGATTGCCAACAGTGTATGCTCGAAATCCTGGATACTGCAGGGACAGAGCAATTTACA GCAATGAGGGATTTGTATATGAAGAACGGCCAAGGTTTTGCACTAGTATATTCTATTACA GCTCAGTCCACGTTTAACGACTTACAGGACCTGAGGGAACAGATTTTACGGGTTAAGGAC ACGGAAGATGTTCCAATGATTTTGGTTGGCAATAAATGTGACCTGGAAGATGAGCGAGTA GTTGGCAAAGAGCAGGGCCAGAATTTAGCAAGACAGTGGTGTAACTGTGCCTTTTTAGAA TCTTCTGCAAAGTCAAAGATCAATGTTAATGAGATATTTTATGACCTGGTCAGACAGATA AATAGGAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCATGTCTGCTGCTCTAG GCCCATAGTCAGCAGCAGCTCTGAGCCAGATTACAGGAATGAAGAACTGTTGCCTAATTG GAAAGTGCCAGCATTCCAGACTTCAAAAATAAAAAATCTGAAGAGGCTTCTCCTGTTTTA TATATTATGTGAAGAATTTAGATCTTATATTGGTTTGCACAAGTTCCCTGGAGAAAAAAA TTGCTCTGTGTATATCTCTTGGAAAATAAGACAATAGTATTTCTCCTTTGCAATAGCAGT TATAACAGATGTGAAAATATACTTGACTCTAATATGATTATACAAAAGAGCATGGATGCA TTTCAAATGTTAGATATTGCTACTATAATCAAATGATTTCATATTGATCTTTTTATCATG ATCCTCCCTATCAAGCACTAAAAAGTTGAACCATTATACTTTATATCTGTAATGATACTG ATTATGAAATGTCCCCTCAAACTCATTGCAGCAGATAACTTTTTTGAGTCATTGACTTCA TTTTATATTTAAAAAATTATGGAATATCATCTGTCATTATATTCTAATTAAAATTGTGCA TAATGCTTTGGAAAAATGGGTCTTTTATAGGAAAAAAACTGGGATAACTGATTTCTATGG CTTTCAAAGCTAAAATATATAATATACTAAACCAACTCTAATATTGCTTCTTGTGTTTTA CTGTCAGATTAAATTACAGCTTTTATGGATGATTAAATTTTAGTACATTTTCAAAAAAAA AAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001010935 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001010935.1, NP_001010935.1 |
RefSeq Size | 1906 bp |
RefSeq ORF | 555 bp |
Locus ID | 5906 |
Cytogenetics | 1p13.2 |
Protein Families | Druggable Genome |
Protein Pathways | Chemokine signaling pathway, Focal adhesion, Leukocyte transendothelial migration, Long-term potentiation, MAPK signaling pathway, Neurotrophin signaling pathway, Renal cell carcinoma |
Gene Summary | 'This gene encodes a member of the Ras family of small GTPases. The encoded protein undergoes a change in conformational state and activity, depending on whether it is bound to GTP or GDP. This protein is activated by several types of guanine nucleotide exchange factors (GEFs), and inactivated by two groups of GTPase-activating proteins (GAPs). The activation status of the encoded protein is therefore affected by the balance of intracellular levels of GEFs and GAPs. The encoded protein regulates signaling pathways that affect cell proliferation and adhesion, and may play a role in tumor malignancy. Pseudogenes of this gene have been defined on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]' Transcript Variant: This variant (1) differs in the 5' UTR, compared to variant 4. Variants 1-5 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204137 | RAP1A (Myc-DDK-tagged)-Human RAP1A, member of RAS oncogene family (RAP1A), transcript variant 1 |
USD 98.00 |
|
RG204137 | RAP1A (GFP-tagged) - Human RAP1A, member of RAS oncogene family (RAP1A), transcript variant 1 |
USD 460.00 |
|
RC204137L1 | Lenti ORF clone of Human RAP1A, member of RAS oncogene family (RAP1A), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC204137L2 | Lenti ORF clone of Human RAP1A, member of RAS oncogene family (RAP1A), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC204137L3 | Lenti ORF clone of Human RAP1A, member of RAS oncogene family (RAP1A), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC204137L4 | Lenti ORF clone of Human RAP1A, member of RAS oncogene family (RAP1A), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review