TPSAB1 (NM_003294) Human Untagged Clone
CAT#: SC324545
TPSAB1 (untagged)-Human tryptase alpha/beta 1 (TPSAB1)
"NM_003294" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TPSAB1 |
Synonyms | TPS1; TPS2; TPSB1; TPSB2; Tryptase-2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_003294.3
AGAAGGAACAGGGAGCGGCCAGGATGCTGAATCTGCTGCTGCTGGCGCTGCCCGTCCTGG
CGAGCCGCGCCTACGCGGCCCCTGCCCCAGGCCAGGCCCTGCAGCGAGTGGGCATCGTTG GGGGTCAGGAGGCCCCCAGGAGCAAGTGGCCCTGGCAGGTGAGCCTGAGAGTCCACGGCC CATACTGGATGCACTTCTGCGGGGGCTCCCTCATCCACCCCCAGTGGGTGCTGACCGCAG CGCACTGCGTGGGACCGGACGTCAAGGATCTGGCCGCCCTCAGGGTGCAACTGCGGGAGC AGCACCTCTACTACCAGGACCAGCTGCTGCCGGTCAGCAGGATCATCGTGCACCCACAGT TCTACACCGCCCAGATCGGAGCGGACATCGCCCTGCTGGAGCTGGAGGAGCCGGTGAAGG TCTCCAGCCACGTCCACACGGTCACCCTGCCCCCTGCCTCAGAGACCTTCCCCCCGGGGA TGCCGTGCTGGGTCACTGGCTGGGGCGATGTGGACAATGATGAGCGCCTCCCACCGCCAT TTCCTCTGAAGCAGGTGAAGGTCCCCATAATGGAAAACCACATTTGTGACGCAAAATACC ACCTTGGCGCCTACACGGGAGACGACGTCCGCATCGTCCGTGACGACATGCTGTGTGCCG GGAACACCCGGAGGGACTCATGCCAGGGCGACTCCGGAGGGCCCCTGGTGTGCAAGGTGA ATGGCACCTGGCTGCAGGCGGGCGTGGTCAGCTGGGGCGAGGGCTGTGCCCAGCCCAACC GGCCTGGCATCTACACCCGTGTCACCTACTACTTGGACTGGATCCACCACTATGTCCCCA AAAAGCCGTGAGTCAGGCCTGGGTTGGCCACCTGGGTCACTGGAGGACCAACCCCTGCTG TCCAAAACACCACTGCTTCCTACCCAGGTGGCGACTGCCCCCCACACCTTCCCTGCCCCG TCCTGAGTGCCCCTTCCTGTCCTAAGCCCCCTGCTCTCTTCTGAGCCCCTTCCCCTGTCC TGAGGACCCTTCCCCATCCTGAGCCCCCTTCCCTGTCCTAAGCCTGACGCCTGCACTGGG CCCTCCGGCCCTCCCCTGCCCAGGCAGCTGGTGGTGGGCGCTAATCCTCCTGAGTGCTGG ACCTCATTAAAGTGCATGGAAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_003294 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_003294.3, NP_003285.2 |
RefSeq Size | 1194 bp |
RefSeq ORF | 828 bp |
Locus ID | 7177 |
Cytogenetics | 16p13.3 |
Domains | Tryp_SPc |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Gene Summary | 'Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. These genes are characterized by several distinct features. They have a highly conserved 3' UTR and contain tandem repeat sequences at the 5' flank and 3' UTR which are thought to play a role in regulation of the mRNA stability. These genes have an intron immediately upstream of the initiator Met codon, which separates the site of transcription initiation from protein coding sequence. This feature is characteristic of tryptases but is unusual in other genes. The alleles of this gene exhibit an unusual amount of sequence variation, such that the alleles were once thought to represent two separate genes, alpha and beta 1. Beta tryptases appear to be the main isoenzymes expressed in mast cells; whereas in basophils, alpha tryptases predominate. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC124210 | TPSAB1 (untagged)-Human tryptase alpha/beta 1 (TPSAB1) |
USD 310.00 |
|
RC205892 | TPSAB1 (Myc-DDK-tagged)-Human tryptase alpha/beta 1 (TPSAB1) |
USD 420.00 |
|
RG205892 | TPSAB1 (GFP-tagged) - Human tryptase alpha/beta 1 (TPSAB1) |
USD 460.00 |
|
RC205892L3 | Lenti ORF clone of Human tryptase alpha/beta 1 (TPSAB1), Myc-DDK-tagged |
USD 620.00 |
|
RC205892L4 | Lenti ORF clone of Human tryptase alpha/beta 1 (TPSAB1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review