LSM5 (NM_001139499) Human Untagged Clone
CAT#: SC324689
LSM5 (untagged)-Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3
"NM_001139499" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LSM5 |
Synonyms | YER146W |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001139499, the custom clone sequence may differ by one or more nucleotides
ATGAAGAGTGATAAGGAAATTGTTGGTACTCTTCTAGGATTTGATGACTTTGTCAATATG GTACTGGAAGATGTCACTGAGTTTGAAATCACACCAGAAGGAAGAAGGATTACTAAATTA GATCAGATTTTGCTAAATGGAAATAATATAACAATGCTGGTTCCTGGAGGAGAAGGACCT GAAGTG |
Restriction Sites | Please inquire |
ACCN | NM_001139499 |
ORF Size | 189 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001139499.1, NP_001132971.1 |
RefSeq Size | 2451 |
RefSeq ORF | 189 |
Locus ID | 23658 |
Protein Families | Stem cell - Pluripotency |
Protein Pathways | RNA degradation, Spliceosome |
Gene Summary | Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. [supplied by OMIM, Apr 2004] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a segment of the 5' coding region, and uses a downstream translation initiation codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. Both variants 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227982 | LSM5 (Myc-DDK-tagged)-Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3 |
USD 420.00 |
|
RG227982 | LSM5 (GFP-tagged) - Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3 |
USD 460.00 |
|
RC227982L3 | Lenti-ORF clone of LSM5 (Myc-DDK-tagged)-Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3 |
USD 620.00 |
|
RC227982L4 | Lenti-ORF clone of LSM5 (mGFP-tagged)-Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review