LSM5 (NM_001139499) Human Untagged Clone

CAT#: SC324689

LSM5 (untagged)-Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3


  "NM_001139499" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "LSM5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LSM5
Synonyms YER146W
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001139499, the custom clone sequence may differ by one or more nucleotides
ATGAAGAGTGATAAGGAAATTGTTGGTACTCTTCTAGGATTTGATGACTTTGTCAATATG
GTACTGGAAGATGTCACTGAGTTTGAAATCACACCAGAAGGAAGAAGGATTACTAAATTA
GATCAGATTTTGCTAAATGGAAATAATATAACAATGCTGGTTCCTGGAGGAGAAGGACCT
GAAGTG
Restriction Sites Please inquire     
ACCN NM_001139499
ORF Size 189 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001139499.1, NP_001132971.1
RefSeq Size 2451
RefSeq ORF 189
Locus ID 23658
Protein Families Stem cell - Pluripotency
Protein Pathways RNA degradation, Spliceosome
Gene Summary Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. [supplied by OMIM, Apr 2004]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a segment of the 5' coding region, and uses a downstream translation initiation codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. Both variants 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.