EIF4E3 (NM_001134650) Human Untagged Clone
CAT#: SC324718
EIF4E3 (untagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4
"NM_001134650" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EIF4E3 |
Synonyms | eIF-4E3; eIF4E-3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001134650, the custom clone sequence may differ by one or more nucleotides
ATGAGAGGAGAGAGGCGACCACTTTGGGAAGAGGAGAGTAATGCAAAGGGTGGCGTATGG AAGATGAAAGTCCCCAAGGACAGCACGTCCACAGTTTGGAAAGAGTTGCTGTTAGCAACC ATCGGGGAACAGTTCACAGACTGTGCCGCAGCAGATGATGAAGTAATAGGAGTTAGTGTC AGTGTTCGGGACCGAGAAGACGTCGTCCAAGTCTGGAATGTAAATGCCTCTTTAGTGGGT GAAGCGACTGTTTTAGAAAAGATCTATGAACTTCTGCCCCACATAACTTTTAAAGCAGTA TTTTATAAACCCCATGAAGAGCATCATGCTTTTGAAGGTGGACGTGGAAAACAC |
Restriction Sites | Please inquire |
ACCN | NM_001134650 |
ORF Size | 357 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001134650.1, NP_001128122.1 |
RefSeq Size | 6100 |
RefSeq ORF | 357 |
Locus ID | 317649 |
Gene Summary | EIF4E3 belongs to the EIF4E family of translational initiation factors that interact with the 5-prime cap structure of mRNA and recruit mRNA to the ribosome (Joshi et al., 2004 [PubMed 15153109]). [supplied by OMIM, Mar 2008] Transcript Variant: This variant (4) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2-5 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225053 | EIF4E3 (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4 |
USD 420.00 |
|
RG225053 | EIF4E3 (GFP-tagged) - Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4 |
USD 460.00 |
|
RC225053L3 | Lenti-ORF clone of EIF4E3 (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4 |
USD 620.00 |
|
RC225053L4 | Lenti-ORF clone of EIF4E3 (mGFP-tagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review