EIF4E3 (NM_001134650) Human Untagged Clone

CAT#: SC324718

EIF4E3 (untagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4


  "NM_001134650" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "EIF4E3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EIF4E3
Synonyms eIF-4E3; eIF4E-3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001134650, the custom clone sequence may differ by one or more nucleotides
ATGAGAGGAGAGAGGCGACCACTTTGGGAAGAGGAGAGTAATGCAAAGGGTGGCGTATGG
AAGATGAAAGTCCCCAAGGACAGCACGTCCACAGTTTGGAAAGAGTTGCTGTTAGCAACC
ATCGGGGAACAGTTCACAGACTGTGCCGCAGCAGATGATGAAGTAATAGGAGTTAGTGTC
AGTGTTCGGGACCGAGAAGACGTCGTCCAAGTCTGGAATGTAAATGCCTCTTTAGTGGGT
GAAGCGACTGTTTTAGAAAAGATCTATGAACTTCTGCCCCACATAACTTTTAAAGCAGTA
TTTTATAAACCCCATGAAGAGCATCATGCTTTTGAAGGTGGACGTGGAAAACAC
Restriction Sites Please inquire     
ACCN NM_001134650
ORF Size 357 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001134650.1, NP_001128122.1
RefSeq Size 6100
RefSeq ORF 357
Locus ID 317649
Gene Summary EIF4E3 belongs to the EIF4E family of translational initiation factors that interact with the 5-prime cap structure of mRNA and recruit mRNA to the ribosome (Joshi et al., 2004 [PubMed 15153109]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (4) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2-5 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.