RNF24 (NM_001134337) Human Untagged Clone

CAT#: SC324733

RNF24 (untagged)-Human ring finger protein 24 (RNF24), transcript variant 2


  "NM_001134337" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNF24"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNF24
Synonyms G1L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001134337, the custom clone sequence may differ by one or more nucleotides


ATGAGCTCGGATTTCCCACATTACAACTTCAGGATGCCTAATATTGGATTCCAGAATCTGCCTCTCAACA
TATATATTGTGGTTTTTGGTACTGCTATATTTGTCTTCATCCTTAGTTTACTCTTCTGTTGCTACTTGAT
TAGGCTAAGACATCAAGCACACAAAGAATTTTATGCCTACAAACAGGTTATATTAAAAGAGAAAGTAAAA
GAATTGAATTTACATGAGCTCTGTGCAGTGTGCCTAGAAGACTTCAAGCCTCGAGATGAGTTGGGGATTT
GCCCATGTAAGCACGCCTTCCACAGAAAGTGCCTTATTAAGTGGCTGGAGGTTCGTAAAGTGTGTCCCCT
GTGCAACATGCCAGTTCTACAGCTGGCCCAGTTGCACAGTAAGCAGGACCGTGGACCCCCTCAGGGGCCC
CTTCCTGGGGCAGAGAACATTGTATAG


Restriction Sites SgfI-MluI     
ACCN NM_001134337
ORF Size 447 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001134337.2, NP_001127809.1
RefSeq Size 7374
RefSeq ORF 447
Locus ID 11237
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes an integral membrane protein that contains a RING-type zinc finger. The encoded protein may interact with multiple transient receptor potential cation channel subfamily C (TRPC) proteins and regulate the trafficking and insertion of these proteins into the plasma membrane. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (2) uses a different segment for its 5' UTR, compared to variant 1. Variants 1, 2 and 4 encode the same isoform (1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.