LMO2 (NM_001142315) Human Untagged Clone

CAT#: SC324747

LMO2 (untagged)-Human LIM domain only 2 (rhombotin-like 1) (LMO2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LMO2
• Synonyms: LMO-2; RBTN2; RBTNL1; RHOM2; TTG2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142315, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTCGGCCATCGAAAGGAAGAGCCTGGACCCTTCAGAGGAACCAGTGGATGAGGTGCTGCAGATCC
  CCCCATCCCTGCTGACATGCGGCGGCTGCCAGCAGAACATTGGGGACCGCTACTTCCTGAAGGCCATCGA
  CCAGTACTGGCACGAGGACTGCCTGAGCTGCGACCTCTGTGGCTGCCGGCTGGGTGAGGTGGGGCGGCGC
  CTCTACTACAAACTGGGCCGGAAGCTCTGCCGGAGAGACTATCTCAGGCTTTTTGGGCAAGACGGTCTCT
  GCGCATCCTGTGACAAGCGGATTCGTGCCTATGAGATGACAATGCGGGTGAAAGACAAAGTGTATCACCT
  GGAATGTTTCAAATGCGCCGCCTGTCAGAAGCATTTCTGTGTAGGTGACAGATACCTCCTCATCAACTCT
  GACATAGTGTGCGAACAGGACATCTACGAGTGGACTAAGATCAATGGGATGATATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142315
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001142315.1, NP_001135787.1
• RefSeq Size: 1605 bp
• RefSeq ORF: 477 bp
• Locus ID: 4005
• Cytogenetics: 11p13
• Protein Families: Druggable Genome
• Gene Summary: 'LMO2 encodes a cysteine-rich, two LIM-domain protein that is required for yolk sac erythropoiesis. The LMO2 protein has a central and crucial role in hematopoietic development and is highly conserved. The LMO2 transcription start site is located approximately 25 kb downstream from the 11p13 T-cell translocation cluster (11p13 ttc), where a number T-cell acute lymphoblastic leukemia-specific translocations occur. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Nov 2008]'
  Transcript Variant: This variant (2) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream in-frame ATG and an isoform (2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2).