HOGA1 (NM_001134670) Human Untagged Clone

CAT#: SC324756

HOGA1 (untagged)-Human 4-hydroxy-2-oxoglutarate aldolase 1 (HOGA1), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HOGA1
• Synonyms: C10orf65; DHDPS2; DHDPSL; HP3; NPL2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001134670, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGGGTCCCCAAGTCTGGTCTTCTGTGAGGCAGGGGCTAAGCAGGAGCTTGTCCAGGAATGTGGGGG
  TCTGGGCCTCAGGGGAGGGGAAGAAGGTGGACATTGCGGGTATCTACCCCCCTGTGACCACCCCCTTCAC
  TGCCACTGCAGAGGTGGACTATGGGAAACTGGAGGAGAATCTGCACAAACTGGGCACCTTCCCCTTCCGA
  GGAGCTGTGGGGGGCGTCTGCGCCCTGGCCAATGTCCTGGGGGCTCAGGTGTGCCAGCTGGAGCGACTGT
  GCTGCACGGGGCAATGGGAAGATGCCCAGAAACTGCAGCACCGCCTCATTGAGCCAAACGCTGCGGTGAC
  CCGGCGCTTTGGGATCCCAGGGCTGAAGAAAATCATGGACTGGTTTGGCTACTATGGAGGCCCCTGCCGC
  GCCCCCTTGCAGGAGCTGAGCCCCGCTGAGGAGGAGGCACTGCGCATGGATTTCACCAGCAACGGCTGGC
  TCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001134670
• ORF Size: 495 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001134670.1, NP_001128142.1
• RefSeq Size: 2012
• RefSeq ORF: 495
• Locus ID: 112817
• Gene Summary: The authors of PMID:20797690 cloned this gene while searching for genes in a region of chromosome 10 linked to primary hyperoxalurea type III. They noted that even though the encoded protein has been described as a mitochondrial dihydrodipicolinate synthase-like enzyme, it shares little homology with E. coli dihydrodipicolinate synthase (Dhdps), particularly in the putative substrate-binding region. Moreover, neither lysine biosynthesis nor sialic acid metabolism, for which Dhdps is responsible, occurs in vertebrate mitochondria. They propose that this gene encodes mitochondrial 4-hydroxyl-2-oxoglutarate aldolase (EC 4.1.3.16), which catalyzes the final step in the metabolic pathway of hydroxyproline, releasing glyoxylate and pyruvate. This gene is predominantly expressed in the liver and kidney, and mutations in this gene are found in patients with primary hyperoxalurea type III. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Nov 2010]
  Transcript Variant: This variant (2) lacks multiple consecutive exons in the coding region, compared to variant 1, resulting in a protein (isoform 2) that lacks a large region of the central protein when compared to isoform 1.