DDAH1 (NM_001134445) Human Untagged Clone
CAT#: SC324768
DDAH1 (untagged)-Human dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant 2
"NM_001134445" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DDAH1 |
Synonyms | DDAH; DDAH-1; DDAHI; HEL-S-16 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001134445 edited
ATGATGAAAGAAGCATTAGAAAAACTTCAGCTCAATATAGTAGAGATGAAAGATGAAAAT GCAACTTTAGATGGCGGAGATGTTTTATTCACAGGCAGAGAATTTTTTGTGGGCCTTTCC AAAAGGACAAATCAACGAGGTGCTGAAATCTTGGCTGATACTTTTAAGGACTATGCAGTC TCCACAGTGCCAGTGGCAGATGGGTTGCATTTGAAGAGTTTCTGCAGCATGGCTGGGCCT AACCTGATCGCAATTGGGTCTAGTGAATCTGCACAGAAGGCCCTTAAGATCATGCAACAG ATGAGTGACCACCGCTACGACAAACTCACTGTGCCTGATGACATAGCAGCAAACTGTATA TATCTAAATATCCCCAACAAAGGGCACGTCTTGCTGCACCGAACCCCGGAAGAGTATCCA GAAAGTGCAAAGGTTTATGAGAAACTGAAGGACCATATGCTGATCCCCGTGAGCATGTCT GAACTGGAAAAGGTGGATGGGCTGCTCACCTGCTGCTCAGTTTTAATTAACAAGAAAGTA GACTCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001134445 |
ORF Size | 549 bp |
Insert Size | 4000 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001134445.1. |
Reference Data | |
RefSeq | NM_001134445.1, NP_001127917.1 |
RefSeq Size | 4023 |
RefSeq ORF | 549 |
Locus ID | 23576 |
Gene Summary | This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225195 | DDAH1 (Myc-DDK-tagged)-Human dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant 2 |
USD 420.00 |
|
RG225195 | DDAH1 (GFP-tagged) - Human dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant 2 |
USD 460.00 |
|
RC225195L3 | Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC225195L4 | Lenti ORF clone of Human dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review