CITED1 (NM_001144887) Human Untagged Clone

CAT#: SC324776

CITED1 (untagged)-Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CITED1
• Synonyms: MSG1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001144887, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCAACAACGTCGAGGCCTGCACTTGATGTCAAGGGTGGCACCTCACCTGCGAAGGAGGATGCCAACC
  AAGAGATGAGCTCCGTGGCCTACTCCAACCTTGCGGTGAAAGATCGCAAAGCAGTGGCCATTCTGCACTA
  CCCTGGGGTAGCCTCAAATGGAACCAAGGCCAGTGGGGCTCCCACTAGTTCCTCGGGATCTCCAATAGGC
  TCTCCTACAACCACCCCTCCCACTAAACCCCCATCCTTCAACCTGCACCCCGCCCCTCACTTGCTGGCTA
  GTATGCACCTGCAGAAACTTAATAGCCAGTATCAGGGGATGGCTGCTGCCACTCCAGGCCAACCCGGGGA
  GGCAGGACCCCTGCAAAACTGGGACTTTGGGGCCCAGGCGGGAGGGGCAGAATCACTCTCTCCTTCTGCT
  GGTGCCCAGAGCCCTGCTATCATCGATTCGGACCCAGTGGATGAGGAAGTGCTGATGTCGCTGGTGGTGG
  AACTGGGGTTGGACCGAGCCAATGAGCTTCCGGAGCTGTGGCTGGGGCAGAATGAGTTTGACTTCACTGC
  GGACTTTCCATCTAGCTGCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001144887
• ORF Size: 582 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001144887.1, NP_001138359.1
• RefSeq Size: 830
• RefSeq ORF: 582
• Locus ID: 4435
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a member of the CREB-binding protein/p300-interacting transactivator with Asp/Glu-rich C-terminal domain (CITED) family of proteins. The encoded protein, also known as melanocyte-specific gene 1, may function as a transcriptional coactivator and may play a role in pigmentation of melanocytes. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
  Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Both variants 1 and 4 encode the same protein.