UCK (UCK1) (NM_001135954) Human Untagged Clone

CAT#: SC324784

UCK1 (untagged)-Human uridine-cytidine kinase 1 (UCK1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UCK1
• Synonyms: URK1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135954, the custom clone sequence may differ by one or more nucleotides
  ATGGCTTCGGCGGGAGGCGAAGACTGCGAGAGCCCCGCGCCGGAGGCCGACCGTCCGCAC
  CAGCGGCCCTTCCTGATAGGGGTGAGCGGCGGCACTGCCAGCGGGAAGTCGACCGTGTGT
  GAGAAGATCATGGAGTTGCTGGGACAGAACGAGGTGGAACAGCGGCAGCGGAAGGTGGTC
  ATCCTGAGCCAGGACAGGTTCTACAAGGTCCTGACGGCAGAGCAGAAGGCCAAGGCCTTG
  AAAGGACAGTACAATTTTGACCATCCAGATGCCTTTGATAATGATTTGATGCACAGGACT
  CTGAAGAACATCGTGGAGGGCAAAACGGTGGAGGTGCCGACCTATGATTTTGTGACACAC
  TCAAGGTTACCAGAGACCACGGTGGTCTACCCTGCGGACGTGGTTCTGTTTGAGGGCATC
  TTGGTGTTCTACAGCCAGGAGATCCGGGACATGTTCCACCTGCGCCTCTTCGTGGACACC
  GACTCCGACGTCAGGCTGTCTCGAAGAGACAAAGAAGTATGCCGATGTGATCATCCCGCG
  AGGAGTGGACAATATGGTTGCCATCAACCTGATCGTGCAGCACATCCAGGACATTCTGAA
  TGG
  
• Restriction Sites: Please inquire
• ACCN: NM_001135954
• ORF Size: 606 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135954.1, NP_001129426.1
• RefSeq Size: 2096
• RefSeq ORF: 606
• Locus ID: 83549
• Protein Families: Druggable Genome
• Protein Pathways: Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism
• Gene Summary: This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
  Transcript Variant: This variant (2) lacks an exon in the 3' coding region which results in a frameshift and an early stop codon, compared to variant 1. This variant encodes isoform b which has a shorter and distinct C-terminus, compared to isoform a.