RAB7L1 (RAB29) (NM_001135662) Human Untagged Clone

CAT#: SC324786

RAB7L1 (untagged)-Human RAB7, member RAS oncogene family-like 1 (RAB7L1), transcript variant 2


  "NM_001135662" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAB29"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAB29
Synonyms RAB7L; RAB7L1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001135662, the custom clone sequence may differ by one or more nucleotides


ATGGGCAGCCGCGACCACCTGTTCAAAGTGCTGGTGGTGGGGGACGCCGCAGTGGGCAAGACGTCGCTGG
TGCAGCGATATTCCCAGGACAGCTTCAGCAAACACTACAAGTCCACGGTGGGAGTGGATTTTGCTCTGAA
GGTTCTCCAGTGGTCTGACTACGAGATAGTGCGGCTTCAGCTGTGGGATATTGCAGGGCAGGAGCGCTTC
ACCTCTATGACACGATTGTATTATCGGGATGCCTCTGCCTGTGTTATTATGTTTGACGTTACCAATGCCA
CTACCTTCAGCAACAGCCAGAGGTGGAAACAGGACCTAGACAGCAAGCTCACACTACCCAATGGAGAGCC
GGTGCCCTGCCTGCTCTTGGCCAACAAGTGTGATCTGTCCCCTTGGGCAGTGAGCCGGGACCAGATTGAC
CGGTTCAGTAAAGAGAACGGTTTCACAGGTTGGACAGAAACATCAGTCAAGGAGAACAAAAATATTAATG
AGGCTATGAGAGTCCTCATTGAAAAGATGATGAGAAATTCCACAGAAGATATCATGTCTTTGTCCACCCA
AGGGGACTACATCAATCTACAAACCAAGTCCTCCAGCTGGTCCTGCTGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001135662
ORF Size 612 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001135662.1, NP_001129134.1
RefSeq Size 3223
RefSeq ORF 612
Locus ID 8934
Protein Families Druggable Genome

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.