Cyclin D3 (CCND3) (NM_001136017) Human Untagged Clone

CAT#: SC324791

CCND3 (untagged)-Human cyclin D3 (CCND3), transcript variant 1


  "NM_001136017" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CCND3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCND3
Synonyms cyclin D3; D3-type cyclin; G1/S-specific cyclin D3; OTTHUMP00000016390
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001136017, the custom clone sequence may differ by one or more nucleotides


ATGAACTACCTGGATCGCTACCTGTCTTGCGTCCCCACCCGAAAGGCGCAGTTGCAGCTCCTGGGTGCGG
TCTGCATGCTGCTGGCCTCCAAGCTGCGCGAGACCACGCCCCTGACCATCGAAAAACTGTGCATCTACAC
CGACCACGCTGTCTCTCCCCGCCAGTTGCGGGACTGGGAGGTGCTGGTCCTAGGGAAGCTCAAGTGGGAC
CTGGCTGCTGTGATTGCACATGATTTCCTGGCCTTCATTCTGCACCGGCTCTCTCTGCCCCGTGACCGAC
AGGCCTTGGTCAAAAAGCATGCCCAGACCTTTTTGGCCCTCTGTGCTACAGATTATACCTTTGCCATGTA
CCCGCCATCCATGATCGCCACGGGCAGCATTGGGGCTGCAGTGCAAGGCCTGGGTGCCTGCTCCATGTCC
GGGGATGAGCTCACAGAGCTGCTGGCAGGGATCACTGGCACTGAAGTGGACTGCCTGCGGGCCTGTCAGG
AGCAGATCGAAGCTGCACTCAGGGAGAGCCTCAGGGAAGCCTCTCAGACCAGCTCCAGCCCAGCGCCCAA
AGCCCCCCGGGGCTCCAGCAGCCAAGGGCCCAGCCAGACCAGCACTCCTACAGATGTCACAGCCATACAC
CTGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001136017
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136017.3, NP_001129489.1
RefSeq Size 2099 bp
RefSeq ORF 636 bp
Locus ID 896
Cytogenetics 6p21.1
Protein Families Druggable Genome
Protein Pathways Cell cycle, Focal adhesion, Jak-STAT signaling pathway, p53 signaling pathway, Wnt signaling pathway
Gene Summary 'The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activtiy is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. The CDK4 activity associated with this cyclin was reported to be necessary for cell cycle progression through G2 phase into mitosis after UV radiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]'
Transcript Variant: This variant (1) differs in the 5' UTR and coding sequence, and represents use of an alternate promoter, compared to variant 2. The resulting isoform (1) is shorter at the N-terminus compared to isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.