Secretogranin V (SCG5) (NM_001144757) Human Untagged Clone

CAT#: SC324792

SCG5 (untagged)-Human secretogranin V (7B2 protein) (SCG5), transcript variant 1


  "NM_001144757" in other vectors (6)

Reconstitution Protocol

USD 540.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SCG5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SCG5
Synonyms 7B2; P7B2; SGNE1; SgV
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_003020.1 GACCCCCACCAAGGCCCATACCGCAGTAGGCTCCTCGGGCTGCCCCTCGGTTGACAATGG
TCTCCAGGATGGTCTCTACCATGCTATCTGGCCTACTGTTTTGGCTGGCATCTGGATGGA
CTCCAGCATTTGCTTACAGCCCCCGGACCCCTGACCGGGTCTCAGAAGCAGATATCCAGA
GGCTGCTTCATGGTGTTATGGAGCAATTGGGCATTGCCAGGCCCCGAGTGGAATATCCAG
CTCACCAGGCCATGAATCTTGTGGGCCCCCAGAGCATTGAAGGTGGAGCTCATGAAGGAC
TTCAGCATTTGGGTCCTTTTGGCAACATCCCCAACATCGTGGCAGAGTTGACTGGAGACA
ACATTCCTAAGGACTTTAGTGAGGATCAGGGGTACCCAGACCCTCCAAATCCCTGTCCTG
TTGGAAAAACAGCAGATGATGGATGTCTAGAAAACACCCCTGACACTGCAGAGTTCAGTC
GAGAGTTCCAGTTGCACCAGCATCTCTCTGATCCGGAACATGACTATCCAGGCTTGGGCA
AGTGGAACAAGAAACTCCTTTACGAGAAGATGAAGGGAGGAGAGAGACGAAAGCGGAGGA
GTGTCAATCCATATCTACAAGGACAGAGACTGGATAATGTTGTTGCAAAGAAGTCTGTCC
CCCATTTTTCAGATGAGGATAAGGATCCAGAGTAAAGAGAAGATGCTAGACGAAAACCCA
CATTACCTGTTAGGCCTCAGCATGGCTTATGTGCACGTGTAAATGGAGTCCCTGTGAATG
ACAGCATGTTTCTTACATAGATAATTATGGATACAAAGCAGCTGTATGTAGATAGTGTAT
TGTCTTCACACCGATGATTCTGCTTTTTGCTAAATTAGAATAAGAGCTTTTTTGTTTCTT
GGGTTTTTAAAATGTGAATCTGCAATGATCATAAAAATTAAAATGTGAATGTCAACAATA
AAAAGCAAGACTATGAAAGGCTCAGATTTCTTGCAGTTTAAAATGGTGTCTGAGGTTGTA
CTATTTTGGCCAAGTCTGTAGAAAGCTGTCATTTGATTTTGATTATGTAGTTCATCCAGC
CCTTGGGCATTGTTATACACCAGTAAAGAAGGCTGTACTCAAGAGGAGGAGCTGACACAT
TTCACTTGGCTGCGTCTTAATAAACATGAATGCAAGCACAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001144757
Insert Size 1200 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001144757.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001144757.1, NP_001138229.1
RefSeq Size 1244 bp
RefSeq ORF 639 bp
Locus ID 6447
Cytogenetics 15q13.3
Protein Families Secreted Protein
Gene Summary 'This gene encodes a secreted chaperone protein that prevents the aggregation of other secreted proteins, including proteins that are associated with neurodegenerative and metabolic disease. The encoded protein may be best known for its role in the trafficking and activation of prohormone convertase PC2 (encoded by Gene ID: 5126). Phosphorylation of the encoded protein has been shown to have an inhibitory effect on its chaperone function. This gene also produces a ARHGAP11A-SCG5 readthrough transcript and ARHGAP11A-SCG5 protein. [provided by RefSeq, Feb 2019]'
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.