Artemin (ARTN) (NM_001136215) Human Untagged Clone

CAT#: SC324811

ARTN (untagged)-Human artemin (ARTN), transcript variant 5


  "NM_001136215" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARTN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARTN
Synonyms ART; ENOVIN; EVN; NBN
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001136215, the custom clone sequence may differ by one or more nucleotides
ATGGAACTTGGACTTGGAGGCCTCTCCACGCTGTCCCACTGCCCCTGGCCTAGGCAGCAG
GCTCCACTTGGTCTCTCCGCGCAGCCTGCCCTGTGGCCCACCCTGGCCGCTCTGGCTCTG
CTGAGCAGCGTCGCAGAGGCCTCCCTGGGCTCCGCGCCCCGCAGCCCTGCCCCCCGCGAA
GGCCCCCCGCCTGTCCTGGCGTCCCCCGCCGGCCACCTGCCGGGGGGACGCACGGCCCGC
TGGTGCAGTGGAAGAGCCCGGCGGCCGCCGCCGCAGCCTTCTCGGCCCGCGCCCCCGCCG
CCTGCACCCCCATCTGCTCTTCCCCGCGGGGGCCGCGCGGCGCGGGCTGGGGGCCCGGGC
AGCCGCGCTCGGGCAGCGGGGGCGCGGGGCTGCCGCCTGCGCTCGCAGCTGGTGCCGGTG
CGCGCGCTCGGCCTGGGCCACCGCTCCGACGAGCTGGTGCGTTTCCGCTTCTGCAGCGGC
TCCTGCCGCCGCGCGCGCTCTCCACACGACCTCAGCCTGGCCAGCCTACTGGGCGCCGGG
GCCCTGCGACCGCCCCCGGGCTCCCGGCCCGTCAGCCAGCCCTGCTGCCGACCCACGCGC
TACGAAGCGGTCTCCTTCATGGACGTCAACAGCACCTGGAGAACCGTGGACCGCCTCTCC
GCCACCGCCTGCGGCTGCCTGGGC
Restriction Sites Please inquire     
ACCN NM_001136215
ORF Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001136215.1, NP_001129687.1
RefSeq Size 1812
RefSeq ORF 687
Locus ID 9048
Protein Families Druggable Genome, Secreted Protein
Gene Summary This gene encodes a secreted ligand of the glial cell line-derived neurotrophic factor (GDNF) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein signals through the RET receptor and GFR alpha 3 coreceptor, and supports the survival of a number of peripheral neuron populations and at least one population of dopaminergic CNS neurons. This protein has also been shown to promote tumor growth, metastasis, and drug resistance in mammary carcinoma. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (5) differs in the 5' UTR and uses an alternate in-frame splice site in the coding region, compared to variant 2. The encoded isoform (3) is longer and lacks a predicted signal peptide compared to isoform 1. Both variants 4 and 5 encode the same isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.