RABL2B (NM_001130920) Human Untagged Clone
CAT#: SC324814
RABL2B (untagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 4
"NM_001130920" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RABL2B |
Synonyms | FLJ93981; FLJ98216 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001130920, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAAGACAAAACCAAACCGAGTGAGTTGGACCAAGGGAAGTATGATGCTGATGAC AACGTGAAGATCATCTGCCTGGGAGACAGCGCAGTGGGCAAATCCAAACTCATGGAGAGA TTTCTCATGGATGGCTTTCAGCCACAGCAGCTGTCCACGTACGCCCTGACCCTGTACAAG CACACAGCCACGGTAGATGGAAGGACCATCCTTGTGGACTTTTGGGACACGGCAGGCCAG GAGCGGTTCCAGAGCATGCATGCCTCCTACTACCACAAGGCCCACGCCTGCATCATGGTG TTTGATGTACAGAGGAAAGTCACCTATAGGAACCTGAGCACCTGGTATACAGAGCTTCGG GAGTTCAGGCCAGAGATCCCATGCATCGTGGTGGCCAATAAAATTGATGCAGACATAAAC GTGACCCAAAAAAGCTTCAATTTTGCCAAGAAGTTCTCCCTGCCCCTGTATTTCGTCTCG GCTGCTGATGGTACCAATGTTGTGAAGCTCTTCAATGATGCAATTCGATTAGCTGTGTCT TACAAACAGAACTCCCAGGACTTCATGGATGAGATTTTTCAGGAGCTCGAGAACTTCAGC TTGGAGCAGGAAGAGGAGGACGTGCCAGACCAGGAACAGAGCAGCAGCATCGAGACCCCA TCAGAGGAGGCGGCCTCTCCCCACAGC |
Restriction Sites | Please inquire |
ACCN | NM_001130920 |
ORF Size | 690 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001130920.1, NP_001124392.1 |
RefSeq Size | 2345 |
RefSeq ORF | 690 |
Locus ID | 11158 |
Protein Families | Druggable Genome |
Gene Summary | The RABL2B protein is a member of the RAB gene family which belongs to the RAS GTPase superfamily. RABL2B is located within a subtelomeric region of 22q13.3. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (4) has multiple differences in the coding sequence compared to variant 7. The resulting isoform (1) has the same N- and C-termini but is shorter compared to isoform 3. Variants 1, 3, 4, 5, 8 and 9 all encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225284 | RABL2B (Myc-DDK-tagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 4 |
USD 420.00 |
|
RG225284 | RABL2B (GFP-tagged) - Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 4 |
USD 460.00 |
|
RC225284L3 | Lenti-ORF clone of RABL2B (Myc-DDK-tagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 4 |
USD 620.00 |
|
RC225284L4 | Lenti-ORF clone of RABL2B (mGFP-tagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review