Myeloid leukemia factor 1 (MLF1) (NM_001130157) Human Untagged Clone

CAT#: SC324824

MLF1 (untagged)-Human myeloid leukemia factor 1 (MLF1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MLF1
• Synonyms: myeloid leukemia factor 1; myeloid leukemia factor 1 variant 1; myeloid leukemia factor 1 variant 2; myeloid leukemia factor 1 variant 3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001130157, the custom clone sequence may differ by one or more nucleotides
  ATGCGACAGATGATAAGAAGTTTTTCTGAACCCTTTGGAAGAGACTTGCTCAGTATCTCT
  GATGGTAGAGGGAGAGCTCATAATCGTAGAGGACATAATGATGGTGAAGATTCTTTGACT
  CATACAGATGTCAGCTCTTTCCAGACAATGGACCAAATGGTGTCAAATATGAGAAACTAT
  ATGCAGAAATTAGAAAGAAACTTCGGTCAACTTTCAGTGGATCCAAATGGACATTCATTT
  TGTTCTTCCTCAGTTATGACTTATTCCAAAATAGGAGATGAACCGCCAAAGGTTTTTCAG
  GCCTCAACTCAAACTCGTCGAGCTCCAGGAGGAATAAAGGAAACCAGGAAAGCAATGAGA
  GATTCTGACAGTGGACTAGAAAAAATGGCTATTGGTCATCATATCCATGACCGAGCTCAT
  GTCATTAAAAAGTCAAAGAACAAGAAGACTGGAGATGAAGAGGTCAACCAGGAGTTCATC
  AATATGAATGAAAGTGATGCTCATGCTTTTGATGAGGAGTGGCAAAGTGAGGTTTTGAAG
  TACAAACCAGGACGACACAATCTAGGAAACACTAGAATGAGAAGTGTTGGCCATGAGAAT
  CCTGGCTCCCGAGAACTTAAAAGAAGGGAGAAACCTCAACAAAGTCCAGCCATTGAACAT
  GGAAGGAGATCAAATGTTTTGGGGGACAAACTCCACATCAAAGGCTCATCTGTGAAAAGC
  AACAAAAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001130157
• Insert Size: 2336 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001130157.1, NP_001123629.1
• RefSeq Size: 2336 bp
• RefSeq ORF: 732 bp
• Locus ID: 4291
• Cytogenetics: 3q25.32
• Protein Families: Druggable Genome
• Gene Summary: 'This gene encodes an oncoprotein which is thought to play a role in the phenotypic determination of hemopoetic cells. Translocations between this gene and nucleophosmin have been associated with myelodysplastic syndrome and acute myeloid leukemia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]'
  Transcript Variant: This variant (2) differs in the 5' UTR and has multiple differences in the coding region, but maintains the reading frame compared to variant 4. This variant encodes isoform 2, which is shorter than isoform 3. Variants 2, 3 and 10 encode the same isoform (2).