MLKL (NM_001142497) Human Untagged Clone

CAT#: SC324866

MLKL (untagged)-Human mixed lineage kinase domain-like (MLKL), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MLKL
• Synonyms: hMLKL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142497, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAAATTTGAAGCATATTATCACCCTTGGCCAGGTCATCCACAAACGGTGTGAAGAGATGAAATACT
  GCAAGAAACAGTGCCGGCGCCTGGGCCACCGCGTCCTCGGCCTGATCAAGCCTCTGGAGATGCTCCAGGA
  CCAAGGAAAGAGGAGCGTGCCCTCTGAGAAGTTAACCACAGCCATGAACCGCTTCAAGGCTGCCCTGGAG
  GAGGCTAATGGGGAGATAGAAAAGTTCAGCAATAGATCCAATATCTGCAGGTTTCTAACAGCAAGCCAGG
  ACAAAATACTCTTCAAGGACGTGAACAGGAAGCTGAGTGATGTCTGGAAGGAGCTCTCGCTGTTACTTCA
  GGTTGAGCAACGCATGCCTGTTTCACCCATAAGCCAAGGAGCGTCCTGGGCACAGGAAGATCAGCAGGAT
  GCAGACGAAGACAGGCGAGCTTTCCAGATGCTAAGAAGAGATAATGAAAAAATAGAAGCTTCACTGAGAC
  GATTAGAAATCAACATGAAAGAAATCAAGGAAACTTTGAGGCAGTCTTTGGAATCGTCCTCTGGGAAATC
  GCCACTGGAGATATCCCGTTTCAAGGTGAAGAATGTGAAGACTGGCTCAGCCAGTGGCTGTAATTCTGAG
  AAGATCCGCAAGCTGGTGGCTGTGAAGCGGCAGCAGGAGCCACTGGGTGAAGACTGCCCTTCAGAGCTGC
  GGGAGATCATTGATGAGTGCCGGGCCCATGATCCCTCTGTGCGGCCCTCTGTGGATGAAATCTTAAAGAA
  ACTCTCCACCTTTTCTAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142497
• ORF Size: 792 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142497.2, NP_001135969.1
• RefSeq Size: 2155
• RefSeq ORF: 792
• Locus ID: 197259
• Protein Families: Druggable Genome, Protein Kinase
• Gene Summary: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to be inactive because it lacks several residues required for activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (RIP3), which is a key signaling molecule in necroptosis pathway. Inhibitor studies and knockdown of this gene inhibited TNF-induced necrosis. High levels of this protein and RIP3 are associated with inflammatory bowel disease in children. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (2, also known as MLKLshRNA-B) lacks several consecutive exons in the mid region and uses an alternate donor splice site at the next exon, which causes a localized frameshift compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter, lacking an internal protein segment compared to isoform 1.