Glutathione S Transferase kappa 1 (GSTK1) (NM_001143679) Human Untagged Clone

CAT#: SC324877

GSTK1 (untagged)-Human glutathione S-transferase kappa 1 (GSTK1), nuclear gene encoding mitochondrial protein, transcript variant 2


  "NM_001143679" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GSTK1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GSTK1
Synonyms GST; GST13; GST 13-13; GST13-13; GSTK1-1; hGSTK1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001143679, the custom clone sequence may differ by one or more nucleotides
ATGGGGCCCCTGCCGCGCACCGTGGAGCTCTTCTATGACGTGCTGTCCCCCTACTCCTGG
CTGGGCTTCGAGATCCTGTGCCGGTATCAGAATATCTGGAACATCAACCTGCAGTTGCGG
CCCAGCCTCATAACAGGGATCATGAAAGACAGTGGAAACAAGCCTCCAGGTCTGCTTCCC
CGCAAAGGACTATACATGGCAAATGACTTAAAGCTCCTGAGACACCATCTCCAGATTCCC
ATCCACTTCCCCAAGGATTTCTTGTCTGTGATGCTTGAAAAAGGAAGTTTGTCTGCCATG
CGTTTCCTCACCGCCGTGAACTTGGAGCATCCAGAGATGCTGGAGAAAGCGTCCCGGGAG
CTGTGGATGCGCGTCTGGTCAAGGGTGAGTGTGGGGCTCTGGGAATCCTCTGGGAGGACC
TTGGATGACTTTCTGACCTTCCCCAGGCACGTTTTCAGGGTCATGATCCTGCCCCCGCCC
GGGGGATCTACTGTCCTCCCAGTCACACCCCTCTCCCCGCACCGCCTTCCTGCTGTCTTC
TCTTCTTCCCAGAATGAAGACATCACCGAGCCGCAGAGCATCCTGGCGGCTGCAGAGAAG
GCTGGTATGTCTGCAGAACAAGCCCAGGGACTTCTGGAAAAGATCGCAACGCCAAAGGTG
AAGAACCAGCTCAAGGAGACCACTGAGGCAGCCTGCAGATACGGAGCCTTTGGGCTGCCC
ATCACCGTGGCCCATGTGGATGGCCAAACCCACATGTTATTTGGCTCTGACCGGATGGAG
CTGCTGGCGCACCTGCTGGGAGAGAAGTGGATGGGCCCTATACCTCCAGCCGTGAATGCC
AGACTT
Restriction Sites Please inquire     
ACCN NM_001143679
ORF Size 849 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001143679.1, NP_001137151.1
RefSeq Size 1226
RefSeq ORF 849
Locus ID 373156
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Gene Summary This gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. The encoded protein (isoform b) is longer compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.