VDAC3 (NM_001135694) Human Untagged Clone

CAT#: SC324880

VDAC3 (untagged)-Human voltage-dependent anion channel 3 (VDAC3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: VDAC3
• Synonyms: HD-VDAC3; VDAC-3
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001135694 edited
  ATGTGTAACACACCAACGTACTGTGACCTAGGAAAGGCTGCTAAGGATGTCTTCAACAAA
  GGATATGGCTTTGGCATGGTCAAGATAGACCTGAAAACCAAGTCTTGTAGTGGAGTGATG
  GAATTTTCTACTTCTGGTCATGCTTACACTGATACAGGGAAAGCATCAGGCAACCTAGAA
  ACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAGAAATGGAACACAGACAAT
  ACTCTAGGGACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTT
  GATACCATATTTGTACCGAACACAGGAAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAA
  CGGGATTGTTTTAGTGTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTAT
  GGCTGGGCTGTGTTGGCCTTCGAAGGGTGGCTTGCTGGCTATCAGATGAGTTTTGACACA
  GCCAAATCCAAACTGTCACAGAATAATTTCGCCCTGGGTTACAAGGCTGCGGACTTCCAG
  CTGCACACACATGTGAACGATGGCACTGAATTTGGAGGTTCTATCTACCAGAAGGTGAAT
  GAGAAGATTGAAACATCCATAAACCTTGCTTGGACAGCTGGGAGTAACAACACCCGTTTT
  GGCATTGCTGCTAAGTACATGCTGGATTGTAGAACTTCTCTCTCTGCTAAAGTAAATAAT
  GCCAGCCTGATTGGACTGGGTTATACTCAGACCCTTCGACCAGGAGTCAAATTGACTTTA
  TCAGCTTTAATCGATGGGAAGAACTTCAGTGCAGGAGGTCACAAGGTTGGCTTGGGATTT
  GAACTGGAAGCTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001135694
• Insert Size: 1557 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001135694.1, NP_001129166.1
• RefSeq Size: 1557 bp
• RefSeq ORF: 1557 bp
• Locus ID: 7419
• Cytogenetics: 8p11.21
• Protein Families: Druggable Genome, Ion Channels: Other
• Protein Pathways: Calcium signaling pathway, Huntington's disease, Parkinson's disease
• Gene Summary: 'This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]'
  Transcript Variant: This variant (2) contains an additional, in-frame 3 nt coding exon compared to variant 1. This results in an isoform (2) that is 1 aa longer than isoform 1. The short exon is supported by PMID:10833333, and orthologs in mouse, rat and bovine.