FMO5 (NM_001144830) Human Untagged Clone

CAT#: SC324881

FMO5 (untagged)-Human flavin containing monooxygenase 5 (FMO5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FMO5
• Synonyms: flavin containing monooxygenase 5; OTTHUMP00000016306
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001144830, the custom clone sequence may differ by one or more nucleotides
  ATGACTAAGAAAAGAATTGCTGTGATTGGGGGAGGAGTGAGCGGGCTCTCTTCCATCAAG
  TGCTGCGTAGAAGAAGGCTTGGAACCTGTCTGCTTTGAAAGGACTGATGACATCGGAGGG
  CTCTGGAGGTTCCAGGAAAATCCTGAAGAAGGAAGGGCCAGTATTTACAAATCAGTGATC
  ATCAATACTTCTAAAGAGATGATGTGCTTCAGTGACTATCCAATCCCAGATCATTATCCC
  AACTTCATGCATAATGCCCAGGTCCTGGAGTATTTCAGGATGTATGCCAAAGAATTTGAC
  CTTCTAAAGTATATTCGATTTAAGACCACTGTGTGCAGTGTGAAGAAGCAGCCTGATTTT
  GCCACTTCAGGCCAATGGGAAGTGGTCACTGAATCTGAAGGGAAAAAGGAGATGAATGTC
  TTTGATGGAGTCATGGTTTGCACTGGCCATCACACCAATGCTCATCTACCTCTGGAAAGC
  TTCCCTGGAATTGAGAAGTTCAAAGGGCAGTACTTCCACAGTCGAGACTATAAGAACCCA
  GAGGGATTCACTGGAAAGAGAGTCATTATAATTGGCATTGGGAATTCTGGAGGGGATCTG
  GCTGTAGAGATTAGCCAAACAGCCAAGCAGGTTTTCCTCAGCACCAGGAGAGGGGCTTGG
  ATCCTGAATCGTGTAGGGGACTACGGATATCCTGCTGATGTGTTGTTCTCTTCTCGACTT
  ACACATTTTATATGGAAGATCTGTGGCCAATCATTAGCAAACAAATATTTGGAAAAAAAG
  ATAAACCAAAGGTTTGACCATGAAATGTTTGGCCTGAAGCCTAAACACAGGTCTAAAGAC
  ATTGCCCTCACAGAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001144830
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001144830.1, NP_001138302.1
• RefSeq Size: 2499 bp
• RefSeq ORF: 858 bp
• Locus ID: 2330
• Cytogenetics: 1q21.1
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Drug metabolism - cytochrome P450
• Gene Summary: 'Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]'
  Transcript Variant: This variant (3) differs in the 5' UTR and lacks an alternate exon in the 3' coding region, compared to variant 1. This results in a frameshift and shorter protein (isoform 3), compared to isoform 1.