Mortality Factor 4 like 2 (MORF4L2) (NM_001142425) Human Untagged Clone

CAT#: SC324890

MORF4L2 (untagged)-Human mortality factor 4 like 2 (MORF4L2), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MORF4L2
• Synonyms: MORFL2; MRGX
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142425, the custom clone sequence may differ by one or more nucleotides
  ATGAGTTCCAGAAAGCAGGGTTCTCAACCTCGTGGACAGCAATCTGCAGAAGAAGAGAAC
  TTCAAAAAACCAACTAGAAGCAACATGCAGAGAAGTAAAATGAGAGGGGCCTCCTCAGGA
  AAGAAGACAGCTGGTCCACAGCAGAAAAATCTTGAACCAGCTCTCCCAGGAAGATGGGGT
  GGTCGCTCTGCAGAGAACCCCCCTTCAGGATCCGTGAGGAAGACCAGAAAGAACAAGCAG
  AAGACTCCTGGAAACGGAGATGGTGGCAGTACCAGCGAAGCACCTCAGCCCCCTCGGAAG
  AAAAGGGCCCGGGCAGACCCCACTGTTGAAAGTGAGGAGGCGTTTAAGAATAGAATGGAG
  GTTAAAGTGAAGATTCCTGAAGAATTAAAACCATGGCTTGTTGAGGACTGGGACTTAGTT
  ACCAGGCAGAAGCAGCTGTTTCAACTCCCTGCCAAGAAAAATGTAGATGCAATTCTGGAG
  GAGTATGCAAATTGCAAGAAATCGCAGGGAAATGTTGATAATAAGGAATATGCGGTTAAT
  GAAGTTGTGGCAGGAATAAAAGAATATTTCAATGTGATGTTGGGCACTCAGCTGCTCTAC
  AAATTTGAGAGGCCCCAGTATGCTGAAATCCTCTTGGCTCACCCTGATGCTCCAATGTCC
  CAGGTTTATGGAGCACCACACCTACTGAGATTATTTGTAAGAATTGGAGCAATGTTGGCC
  TATACGCCCCTTGATGAGAAAAGCCTTGCATTATTGTTGGGCTATTTGCATGATTTCCTA
  AAATATCTGGCAAAGAATTCTGCATCTCTCTTTACTGCCAGTGATTACAAAGTGGCTTCT
  GCTGAGTACCACCGCAAAGCCCTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001142425
• ORF Size: 867 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142425.1, NP_001135897.1
• RefSeq Size: 1967
• RefSeq ORF: 867
• Locus ID: 9643
• Protein Families: Transcription Factors
• Gene Summary: Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histone H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Also component of the MSIN3A complex which acts to repress transcription by deacetylation of nucleosomal histones. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (9) differs in the 5' UTR, compared to variant 1.