Mortality Factor 4 like 2 (MORF4L2) (NM_001142428) Human Untagged Clone

CAT#: SC324893

MORF4L2 (untagged)-Human mortality factor 4 like 2 (MORF4L2), transcript variant 12


  "NM_001142428" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MORF4L2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MORF4L2
Synonyms MORFL2; MRGX
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001142428, the custom clone sequence may differ by one or more nucleotides
ATGAGTTCCAGAAAGCAGGGTTCTCAACCTCGTGGACAGCAATCTGCAGAAGAAGAGAAC
TTCAAAAAACCAACTAGAAGCAACATGCAGAGAAGTAAAATGAGAGGGGCCTCCTCAGGA
AAGAAGACAGCTGGTCCACAGCAGAAAAATCTTGAACCAGCTCTCCCAGGAAGATGGGGT
GGTCGCTCTGCAGAGAACCCCCCTTCAGGATCCGTGAGGAAGACCAGAAAGAACAAGCAG
AAGACTCCTGGAAACGGAGATGGTGGCAGTACCAGCGAAGCACCTCAGCCCCCTCGGAAG
AAAAGGGCCCGGGCAGACCCCACTGTTGAAAGTGAGGAGGCGTTTAAGAATAGAATGGAG
GTTAAAGTGAAGATTCCTGAAGAATTAAAACCATGGCTTGTTGAGGACTGGGACTTAGTT
ACCAGGCAGAAGCAGCTGTTTCAACTCCCTGCCAAGAAAAATGTAGATGCAATTCTGGAG
GAGTATGCAAATTGCAAGAAATCGCAGGGAAATGTTGATAATAAGGAATATGCGGTTAAT
GAAGTTGTGGCAGGAATAAAAGAATATTTCAATGTGATGTTGGGCACTCAGCTGCTCTAC
AAATTTGAGAGGCCCCAGTATGCTGAAATCCTCTTGGCTCACCCTGATGCTCCAATGTCC
CAGGTTTATGGAGCACCACACCTACTGAGATTATTTGTAAGAATTGGAGCAATGTTGGCC
TATACGCCCCTTGATGAGAAAAGCCTTGCATTATTGTTGGGCTATTTGCATGATTTCCTA
AAATATCTGGCAAAGAATTCTGCATCTCTCTTTACTGCCAGTGATTACAAAGTGGCTTCT
GCTGAGTACCACCGCAAAGCCCTG
Restriction Sites Please inquire     
ACCN NM_001142428
ORF Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001142428.1, NP_001135900.1
RefSeq Size 1978
RefSeq ORF 867
Locus ID 9643
Protein Families Transcription Factors
Gene Summary Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histone H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Also component of the MSIN3A complex which acts to repress transcription by deacetylation of nucleosomal histones. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (12) differs in the 5' UTR, compared to variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.