MPST (NM_001130517) Human Untagged Clone

CAT#: SC324908

MPST (untagged)-Human mercaptopyruvate sulfurtransferase (MPST), nuclear gene encoding mitochondrial protein, transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MPST
• Synonyms: MST; TST2; TUM1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001130517, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTTCGCCGCAGCTCTGCCGCGCGCTGGTGTCGGCGCAATGGGTGGCGGAGGCGCTGCGGGCCCCGC
  GCGCTGGGCAGCCTCTGCAGCTGCTGGACGCCTCCTGGTACCTGCCGAAGCTGGGGCGCGACGCGCGACG
  CGAGTTCGAGGAGCGCCACATCCCGGGCGCCGCTTTCTTCGACATCGACCAGTGCAGCGACCGCACCTCG
  CCCTACGACCACATGCTGCCCGGGGCCGAGCATTTCGCGGAGTACGCAGGCCGCCTGGGCGTGGGCGCGG
  CCACCCACGTCGTGATCTACGACGCCAGCGACCAGGGCCTCTACTCCGCCCCGCGCGTCTGGTGGATGTT
  CCGCGCCTTCGGCCACCACGCCGTGTCACTGCTTGATGGCGGCCTCCGCCACTGGCTGCGCCAGAACCTC
  CCGCTCAGCTCCGGCAAGAGCCAACCTGCTCCCGCCGAGTTCCGCGCTCAGCTCGACCCCGCCTTCATCA
  AGACCTACGAGGACATCAAGGAGAACCTGGAATCCCGGCGCTTCCAGGTGGTGGACTCCCGAGCCACTGG
  CAGGTTCCGCGGCACCGAGCCCGAGCCCCGAGACGGCATTGAACCTGGCCACATCCCAGGTACCGTGAAC
  ATCCCCTTCACAGACTTCCTGAGCCAGGAGGGGCTGGAGAAGAGCCCTGAGGAGATCCGCCATCTGTTCC
  AGGAGAAGAAAGTGGACCTGTCTAAGCCACTGGTGGCCACGTGTGGCTCTGGCGTCACAGCCTGCCACGT
  GGCACTAGGGGCCTACCTCTGCGGCAAGCCAGACGTGCCCATCTACGATGGCTCCTGGGTGGAGTGGTAC
  ATGCGCGCCCGGCCCGAGGATGTCATCTCAGAGGGCCGGGGGAAGACCCACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001130517
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001130517.2, NP_001123989.1
• RefSeq Size: 1547 bp
• RefSeq ORF: 894 bp
• Locus ID: 4357
• Cytogenetics: 22q12.3
• Protein Families: Druggable Genome
• Protein Pathways: Cysteine and methionine metabolism, Metabolic pathways
• Gene Summary: 'This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) uses an alternate donor splice site at the first exon and contains an additional 5' non-coding exon compared to variant 1. This results in translation initiation from a downstream AUG, and an isoform (2) with a shorter N-terminus compared to isoform 1. Transcript variants 2 and 3 encode the same isoform.